CEA-carcinoembryonic antigen

 

Forward Primer:5'- AACTTCTCCTGGTCTCTCAGCT -3'

Reverse Primer: 5'- GCAAATGCTTTAAGGAAGAAC - 3'

Probe #1 Sequence: 5'- TGAAATGAAGAAACTACACCAGG-Fl -3'

Probe #2 Sequence: 5'- LC640-CTGCTATATCAGAGCAACCCCAA-P -3'

Product Size: 307 b.p.

Primer Concentration: 0.25 micromolar

Probe Concentration: 0.4 micromolar

Annealing Temperature: 50°C

Magnesium Chloride Concentration: 4 mM

Instrument: Roche LightCycler

 

Submitted by: Hayao Nakanishi

Institution: Laboratory of Pathology, Aichi Cancer Center Research Institute