Albumin

 

Forward Primer:5'- TGTTGCATGAGAAAACGCCA -3'

Reverse Primer: 5'- GTCGCCTGTTCAACCAAGGAT - 3'

Probe Sequence: 5'- AAGTGACAGAGTCACCAAATGCTGCACAG -3'

Product Size: 32b.p.

Primer Concentration: 0.2 micromolar

Probe Concentration: 0.2 micromolar

Annealing Temperature: 60°C

Magnesium Chloride Concentration: 2 mM

Instrument: ABI PRISM 7000

 

Submitted by: Nassim Djebli

Institution: DEXO Labo Pharmacologie Medecine