Symbol Name Accession Size Region Forward Reverse JUN-1 NM_002228 268 1550-1817 CTACGCAAACCTCAGCAAC CTTCCTCTCCGCCTTGAT JUN-2 NM_002228 159 1209-1368 AAGAACTCGGACCTCCTCAC CTCCTGCTCATCTGTCACG JUN-3 NM_002228 236 TCCCCTAACCTCTTTTCTGC AACATCGCACTATCCTTTGG ABHD3 abhydrolase domain containing 3 NM_138340 173 1217-1389 GGAGGCCATATTGGTTTTCT CTAAGCTGAGCTGCCTTCAC ACP5 acid phosphatase 5, tartrate resistant NM_001111035 230 1402-1631 GGGAAACACAGCTGATGAAC TTCAGCCTTGGCAACTATTC ACP5 acid phosphatase 5, tartrate resistant NM_001111035 236 527-762 TCACTGGTGTGCAAGACATC AAAAATGGCCACAGACACAT ACP5 acid phosphatase 5, tartrate resistant NM_001111035 152 724-875 TTCAAGATCCCACAGACCAA TGTTTCTTGAGCCAGGACAG ACP5 acid phosphatase 5, tartrate resistant NM_001111035 175 1360-1534 AGGCTTTTCCTCCAACCTGT GGAACTCAGCAAAGGTGAGC ACP5 acid phosphatase 5, tartrate resistant NM_001111035 241 486-726 GGGTGCAGACTTCATCCTGT GAAGTGCAGGCGGTAGAAAG ACP5 acid phosphatase 5, tartrate resistant NM_001111035 244 1174-1417 GGCTTTGCCTATGTGGAGAT ATCAGCTGTGTTTCCCCTTC ACPP acid phosphatase, prostate NM_001099 199 59-257 CCTAACTCCTGCCAGAAACA TCAGTGGGAAAGGTGTCAAT ACPP acid phosphatase, prostate NM_001099 189 1007-1195 TCCTTCCTCCCTATGCTTCT ACCAGTCTTGAGGGATCACA ACPP acid phosphatase, prostate NM_001099 152 416-567 TTGACCGGACTTTGATGAGT CCTGAAAGGCAGGTATAGCA ACTA2-1 Actin, alpha 2, smooth muscle, aorta NM_001613 165 768-932 AGTTACGAGTTGCCTGATGG GAGGTCCTTCCTGATGTCAA ACTB 76 CAAGAGAGGCATCCTCACCC GATTTTCTCCATGTCGTCCC ACVR1B activin A receptor, type IB NM_004302 224 4012-4235 CTCCTCTTCCCAGAGTCACA CAAAAACACGGCTTCAGTTT ACYP2 acylphosphatase 2, muscle type NM_138448 168 482-649 AGGGTGTTTGCTTCAGAATG GAGAACTAGGGCTTCCAACC ACYP2 acylphosphatase 2, muscle type NM_138448 210 449-658 AATCCGTGGACTACGAGGTG GGTCAATGCGAGAACTAGGG ACYP2 acylphosphatase 2, muscle type NM_138448 199 431-629 CTACCGCCCAGTCACTCAAA TTGCTCAGCCAGGACTTCAT ADAM19 ADAM metallopeptidase domain 19 NM_023038 160 2019-2178 CTGAAGGCTGTGGGAAGAAG ACCACAGGACCCACACTCTC ADAM19 ADAM metallopeptidase domain 19 NM_023038 180 479-658 CTGATTACGGTGAGCAGCAA TCGCTTCTTGGTCTGTTGTG ADAM19 ADAM metallopeptidase domain 19 NM_023038 185 1209-1373 CCAAAGTGTTCAATGGATGC GCAGGGGTTGTTACATTCCT ADAM9 ADAM metallopeptidase domain 9 NM_003816 180 482-661 GACTCAGAGGATTGCTGCAT GAGGCTCTTCCTCTTCATCC ADAMTS18 ADAM metallopeptidase with thrombospondin type 1 motif, 18 NM_199355 175 3732-3906 GACTTGGAAGAGACCTGCAA GGAGCAGACAACTTGAGGAA ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif, 4 NM_005099 177 1972-2148 TCAATATTCCACAGGCTGGT AGTCCTCAGTGTTGCAGGAG ADIPOQ adiponectin, C1Q and collagen domain containing NM_004797 340 1074-1313 CCACTGTCTCTCCTGATGCT GTGAGGTGGGAAACAGACAC ADIPOQ adiponectin, C1Q and collagen domain containing NM_004797 232 3085-3316 TGTCCTTCTGTTCTGCCTTC GAGCAATGAGATGCAAGGTT ADIPOQ adiponectin, C1Q and collagen domain containing NM_004797 151 469-619 CCCATTCGCTTTACCAAGAT CCTTCTTGAAGAGGCTGACC ADIPOQ adiponectin, C1Q and collagen domain containing NM_004797 228 516-743 TGGCTCCACTGGTAAATTCC TCTCCTTCCCCATACACCTG ADIPOR1 adiponectin receptor 1 NM_015999 224 568-791 CCTGACTGGCTAAAGGACAA ATCCCAAAAACCACCTTCTC ADIPOR1 adiponectin receptor 1 NM_015999 203 1680-1882 TTTTACCCTCTCCTCCAACC AGATCCAGGCCCTAGAAAGA ADIPOR1 adiponectin receptor 1 NM_015999 207 636-842 TTGCTTCAAGAGCATCTTCC GTGTGAAAGAGCCAGGAGAA ADIPOR1 adiponectin receptor 1 NM_015999 230 912-1141 AATTATGGGGAGCTTTGTCC CAAAGCCCTCAGCGATAGTA ADIPOR2 adiponectin receptor 2 NM_024551 174 124-297 ATCCTGAAGGTCCATTCTCC CACCTCTTCGTGTACCATCC ADIPOR2 adiponectin receptor 2 NM_024551 233 3663-3895 GCCTGAATGCCTTACTCTCA ACCATCACACAGATGCCTTT ADIPOR2 adiponectin receptor 2 NM_024551 166 1010-1175 CCCTCAGTATCGGGGAGTAA GGCAGCTCCTGTGATGTAGA ADIPOR2 adiponectin receptor 2 NM_024551 232 2549-2780 TTGGTAGACCCTTCCTTTGG GTACCTCACTCCCTGGCAAT ADORA2B AFP-1 NM_001134 272 1606-1877 CATATGTCCCTCCTGCATTC TTAAACTCCCAAAGCAGCAC AFP-2 NM_001134 242 635-877 AAATGCAGTTGAATGCTTCC AATCCAGCACATCTCCTCTG AFP-3 NM_001134 287 CCCACTGGAGATGAACAGTC AAGGGATGCCTTCTTGCTAT AGR2 anterior gradient homolog 2 NM_006408 169 54-222 CACTAGTGGGTGGGATTGAG AGGAGCAAGAATGCTGACAC AGR2 anterior gradient homolog 2 NM_006408 254 491-744 GAGCAGTTTGTCCTCCTCAA AGACAGAAGGGCTTGGAGAT AGR2 anterior gradient homolog 2 NM_006408 117 185-301 GCCATGGAGAAAATTCCAGT GGGTCGAGAGTCCTTTGTGT AGRN agrin NM_198576 191 6967-7157 GGGTCTCATCTTTCCCATCT CGTTGCAGTTTAAGGCATTT AGRN agrin NM_198576 170 2005-2174 AGCAGACACAGATCGAGGAG GCTGAAGTCACAGACACACG AK1 adenylate kinase 1 NM_000476 153 226-378 TGTGAGAAGATCGTGCAGAA CATGTCCAACACTGTCTCCA AKR1B10 aldo-keto reductase family 1, member B10 NM_020299 184 451-634 GATCCAAGAGAAGGCTGTGA GAAAAGGTCATCCCCAGACT AKR1B10 aldo-keto reductase family 1, member B10 NM_020299 194 157-350 ACCACTGCACTCTAGCCTTG TCACTTTGCCAAGAGGAGAC AKR1B10 aldo-keto reductase family 1, member B10 NM_020299 151 247-397 AATCATTTCTGCACCAACCA GTCAATGTGCCGATATCCTG AKT1 v-akt murine thymoma viral oncogene homolog 1 NM_005163 189 2774-2963 ACCTTTTCGACGCTTAACCT TGGAGGGAAGGTTCCATATT AKT1 v-akt murine thymoma viral oncogene homolog 1 NM_005163 174 2184-2358 GAAAACTATCCTGCGGGTTT CTGACAGAGTGAGGGGACAC AKT1 v-akt murine thymoma viral oncogene homolog 1 NM_005163 179 2511-2685 CTAAGGCCGTGTCTCTGAGG GAGGGCTTTCCTGTCACAAA AKT1S1 AKT1 substrate 1 NM_032375 207 1706-1912 TTGGGTCTGTCGTCTCTCTC AGAGACTGGTCAAGCCCTTT AKT2 v-akt murine thymoma viral oncogene homolog 2 NM_001626 245 2456-2701 TGCCTTACTAGGGCTTCCTT CTAGGAGCCTCCCTTTTCAG AKT2 v-akt murine thymoma viral oncogene homolog 2 NM_001626 165 3021-3186 ACACCTCTGGGTGTTTGGAG AGGGACGGAGAACTGTCAGA AKT2 v-akt murine thymoma viral oncogene homolog 2 NM_001626 176 4428-4604 TTTCCCAAGAAGGGTGTTTG CTCCCAAATTGCTGGGATTA ALKBH2 alkB, alkylation repair homolog 2 NM_001001655 150 549-698 TGGGCTGACCTACACATTTT ATGTGGTCACAGCCATCTTT ALKBH3 alkB, alkylation repair homolog 3 NM_139178 187 1302-1488 GAGCAAACCTTCCACTGAGA ATAGCGATTTTGAGCTGTGG ALKBH3 alkB, alkylation repair homolog 3 NM_139178 201 87-287 AAGTGCGCCTTCCTGACTTA CACGGTTGAGGTGCAGACTA ALKBH3 alkB, alkylation repair homolog 3 NM_139178 122 1351-1472 CCACTGAGAAGCCACTTCAA CAACATGAGTTGCTGGCTTT ALKBH3 alkB, alkylation repair homolog 3 NM_139178 203 736-938 ACGTGAAAGAAGCTGACTGG AATGCGGTTCTTTAGTGTGC AMBRA1 autophagy/beclin-1 regulator 1 NM_017749 181 2379-2559 CAACCAGGGTCCATCAGTAG TTCATGAAAAATCCCAGCAT AMPH amphiphysin NM_001635 170 2138-2307 TCACCCGACGCTTAGATTAG GCACACATGCTCCATTGATA AMPH amphiphysin NM_001635 280 CATTCCTTCGGTGGTCATAG ATCATGCAGTGTTTCCACCT AMPH amphiphysin NM_001635 261 GGGAAAGCTGATGAGACAAA ATCCACGAGTTTTTGATGGA ANGPT1 Angiopoietin 1 NM_001146 205 GATGGTGGTTTGATGCTTGT CGGATTTCTTTGTTGCTTTC ANGPT1-2 Angiopoietin 1 NM_001146 152 2220-2371 GAAGAAACTGCTGAGCTTGC TGGCAGGCTTGTTTCTATTC ANGPT1-3 Angiopoietin 1 NM_001146 170 1956-2125 AGATTTTTGAAAGCGCAATG CCAGATTCACGGTCAAGAAC ANGPT1-4 Angiopoietin 1 NM_001146 171 752-922 AGTGGCTGCAAAAACTTGAG CCTGGGTCTCAACATCTGTC ANGPT2 Angiopoietin 2 NM_001147 283 TCAAATCAGGACACACCACA TCATTCCCTTCCCAGTCTTT ANGPT2-2 Angiopoietin 2 NM_001147 208 802-1009 TTCAGCTCTTGGAACACTCC ATGATGGAATTTTGCTTGGA ANGPT2-3 Angiopoietin 2 NM_001147 211 1565-1775 AATAAGCAGCATCAGCCAAC ATAGCCTGAGCCTTTCCAGT ANGPT2-4 Angiopoietin 2 NM_001147 234 3540-3773 GCAAGGAAGTTCAGAGTCCA AGTGCACCTTGGTGGAAATA ANGPTL4 angiopoietin-like 4 NM_001039667 201 1331-1531 ACGAAAGACGGTGACTCTTG ACGCCTCTAGAGTCTGAGCA ANGPTL4 angiopoietin-like 4 NM_001039667 220 #3 CAGCAACTCTTCCACAAGGT GAATTACTGTCCAGCCTCCA ANGPTL4 angiopoietin-like 4 NM_001039667 TGGACCACAAGCACCTAGAC AGTTCACCAAAAATGGCGGAG ANGPTL4 angiopoietin-like 4 NM_139314 278 608-885 AGCATCTGCAAAGCCAGTTT GCGCCTCTGAATTACTGTCC ANLN anillin, actin binding protein NM_018685 154 2409-2562 tcaagctagccaggctctta ctgaggtccttcgttcttca ANXA1 annexin A1 NM_000700 197 226-422 TGCATAAGGCCATAATGGTT CGCTGGAGTTTTTAGCAGAG ANXA1 annexin A1 NM_000700 197 852-1048 ATTGAGAAATGCCTCACAGC TGGCAAAGGGAGATACCATA ANXA10 annexin A10 NM_007193 166 856-1021 GCTGGTTGCAATTGTTCTCT TCGCTCTTTGTATCGTTTCC ANXA10 annexin A10 NM_007193 191 667-857 TCAGGATGCAATGGTCCTAT GCAGCTCCTGAAAGTATCCA ANXA11 annexin A11 NM_001157 195 1632-1826 ACCTCCTGGACATCAGATCA ACATTCTTTTGGCCTTTTCC ANXA11 annexin A11 NM_001157 249 1053-1301 CCCCAGTCCTCTTTGACATT ACATGTCCACGTTTGTGCTT ANXA11 annexin A11 NM_001157 216 1761-1976 TGACTGGTGGCTCACTTCTG CTGTGAGGGATGGGGTAGAA ANXA13 annexin A12 NM_004306 225 475-699 GAGCCTCGAATCAGATGTCA AAGGTGGCTCGTAACTGCTT ANXA13 annexin A12 NM_004306 162 90-251 CTAAAGCGAGCAGTCCTCAG ACGTTGCCTTGTACTTTTGC ANXA13 annexin A12 NM_004306 244 414-657 GCACGAGGACCAATAAGGAA TCATTGAACGCAAGCTCATC ANXA2 annexin A2 NM_001002858 155 794-948 CCCCACCTCCAGAAAGTATT AGCCGATCAGCAAAATACAG ANXA2 annexin A2 NM_001002858 210 179-388 TCTACACCCCCAAGTGCATA CAGTGCTGATGCAAGTTCCT ANXA3 annexin A3 NM_005139 250 774-993 GTTCCGAAACATCTGGTGAC ATGCTGTCCACAATGTCCTT ANXA3 annexin A3 NM_005139 167 355-521 TCCAGACTTTAGCCCATCAG CATCTTTCAGCTCCTTTCCA ANXA4 annexin A4 NM_001153 180 450-629 TAAGCCAAACCTACCAGCAG TCTCTCCAGCCTCATACAGG ANXA4 annexin A4 NM_001153 243 227-469 CAGGAGATCAGGACAGCCTA CTGCTGGTAGGTTTGGCTTA ANXA5 annexin A5 NM_001154 186 197-382 CACAGGTTCTCAGAGGCACT CCCTGCCAAACAGAGTCTTA ANXA5 annexin A5 NM_001154 186 1214-1399 GCACCTTTAGCTGCATTTGT TGGCCAGGCATTAAACTTAG ANXA5 annexin A5 NM_001154 236 935-1170 CTGCCTACCTTGCAGAGACC CTTCCCCGTGACACGTTAGT ANXA5 annexin A5 NM_001154 177 776-952 TCACCATCTTTGGAACACGA TCTCTGCAAGGTAGGCAGGT ANXA6 annexin A6 NM_001155 176 1075-1250 ACACCTCTGGCGAGTACAAG GTCAGGGTTGAAGTCATTGG ANXA6 annexin A6 NM_001155 188 1787-1974 ACGTTTCATGACGATCCTGT GTTTGTCGGCAAAGAAGAGA ANXA7 annexin A7 NM_001156 221 372-592 GTATCCACAGCCACCTTCAC CCTTCATTGCCTTACGAAGA ANXA7 annexin A7 NM_001156 221 573-793 TCTTCGTAAGGCAATGAAGG GTAAGCTCCAGGCATCGTAA ANXA8 annexin A8 NM_001630 175 1365-1539 ACTTCCTCCAGGTCATTTCC GGCTGGGGTCTGTATAACCT ANXA8 annexin A8 NM_001630 226 329-554 ATGTGCTCACCAAGAGAAGC GCCAGGATCTCAATGATGAC ANXA9 annexin A9 NM_003568 161 256-416 ACACCCCCACTTTCCTCTAC GTCAGCAGGTGCAATCTCTT ANXA9 annexin A9 NM_003568 217 59-275 TGAGAGGCTGAGTGGAGTTC GTAGAGGAAAGTGGGGGTGT ANXA9 annexin A9 NM_003568 195 1597-1791 GGATAACCCCTCACTGAGCA ATGTTCTGGCCAGGGTACAG APCDD1 adenomatosis polyposis coli down-regulated 1 NM_153000 216 339-554 CAGAGCAGGACTGGAAATGT ACTGTGATCCTTGCACCATT APCDD1 adenomatosis polyposis coli down-regulated 1 NM_153000 171 1504-1674 GTCTTCAACGGGAATGAGTG ACCGTTGAACAGCAGATAGC APCDD1 adenomatosis polyposis coli down-regulated 1 NM_153000 162 785-946 ACTACCAGCTGCACAACGTC ACTCACAGCCGTTCTCCTCT APCDD1 adenomatosis polyposis coli down-regulated 1 NM_153000 193 1163-1355 TCTATCGGTCAGACGAGCAC CACACCGGGTCTGAGTAGTG APEX2 APEX nuclease (apurinic/apyrimidinic endonuclease) 2 NM_014481 191 937-1127 AGACACCTTTCAGGCCTCTT CAGGACTTTGTTCGAGAGGA APEX2 APEX nuclease (apurinic/apyrimidinic endonuclease) 2 NM_014481 236 777-1012 GCCAGTCTGCCTCTCATGTA ACTCAAGACTGCACCCACAG APOA1-3 apolipoprotein A-I NM_000039 190 166-355 TGGATGTGCTCAAAGACAGC AGGCCCTCTGTCTCCTTTTC APOA1-4 apolipoprotein A-I NM_000039 191 246-436 CTCCTTGACAACTGGGACAG TGCCACTTCTTCTGGAAGTC APOA1-5 apolipoprotein A-I NM_000039 164 98-261 TTTCTGGCAGCAAGATGAAC CCCAGTTGTCAAGGAGCTTT APOA2 apolipoprotein A-II NM_001643 248 201-448 TGATGGAGAAGGTCAAGAGC AAAGAGTGGGTAGGGACAGG APOA2 apolipoprotein A-II NM_001643 182 7-188 AGACACCAAGGACAGAGACG AGTCAGTCACGGTCTGGAAG APOA2 apolipoprotein A-II NM_001643 197 81-277 TGCTACTCCTCACCATCTGC TGTCAGCTGCTCCTTTGACT APOA5 apolipoprotein A-V NM_052968 168 1523-1690 CCACAGAGAGGAGCACTTGT CTCTGCCCTCTCCTATCACA APOA5 apolipoprotein A-V NM_052968 188 1560-1747 GGCAGCTATCAGGGGAATAG ACAGTTGGGAGGGTTCAGTC APOA5 apolipoprotein A-V NM_052968 228 184-411 GCCTTGAGCAAGACCTCAAC CCATCGTGTAGGGCTTCAGT APOB-3 apolipoprotein B (including Ag(x) antigen) NM_000384 210 11463-11672 TTTGCCCTCAACCTACCAAC TGCGATCTTGTTGGCTACTG APOB-4 apolipoprotein B (including Ag(x) antigen) NM_000384 176 10544-10719 CGCTAAAGGAGCAGTTGACC TCACTGAAGACCGTGTGCTC APOB-5 apolipoprotein B (including Ag(x) antigen) NM_000384 154 3205-3358 ACAGAGCCTTGGTGGATACC AGGATTGTTCCGAGGTCAAC APOBEC3G apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G NM_021822 167 704-870 AGCACTGTTGGAGCAAGTTC TCTGACCCAAGGTTCATTGT APOBEC3G apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G NM_021822 231 230-460 GGATGAAGCCTCACTTCAGA ACTTGCTGAACCAGTGGAAG APOC1 apolipoprotein C-I NM_001645 244 204-447 GGAGTTTGGAAACACACTGG ATTTTTATTGGTGGCACCTG APOC1 apolipoprotein C-I NM_001645 229 55-283 TCCAGCAAGGATTCAGAGTG GCATCTTGGCAGAAAGTTCA APOC1 apolipoprotein C-I NM_001645 232 127-358 GTTCTGTCGATCGTCTTGGA GTCACCCTTCAGGTCCTCAT APOC2 apolipoprotein C-II NM_000483 190 384-573 TTTCTGTGCTGAAGGGAGAG CCATCCATGAGAAGCAACTT APOC2 apolipoprotein C-II NM_000483 187 215-401 ACCCAGGTGAAGGAATCTCT CTCCCTTCAGCACAGAAAGA APOC2 apolipoprotein C-II NM_000483 182 117-298 TCCTCCCAGCTCTGTTTCTT GGGCAGGTATGTCTTCTCGT APOC3 apolipoprotein C-III NM_000040 176 134-309 AGCTTCATGCAGGGTTACAT TCCAAATCCCAGAACTCAGA APOC3 apolipoprotein C-III NM_000040 242 140-381 ATGCAGGGTTACATGAAGCA GATGGATAGGCAGGTGGACT APOC3 apolipoprotein C-III NM_000040 242 233-474 GTGACCGATGGCTTCAGTTC ATGAGGTGGGGTAGGAGAGC APOC3 apolipoprotein C-III NM_000040 208 265-472 CTGGAGCACCGTTAAGGACA GAGGTGGGGTAGGAGAGCAC APOC3 apolipoprotein C-III NM_000040 165 120-284 ATGCCTCCCTTCTCAGCTTC TGTCCTTAACGGTGCTCCAG APOC3 apolipoprotein C-III NM_000040 176 291-466 CTGAGTTCTGGGATTTGGAC GGGTAGGAGAGCACTGAGAA APOD apolipoprotein D NM_001647 215 37-251 TCCCATCTTTGTGTTTCGAT GGACCTGGAGCTTTTCTTTC APOD apolipoprotein D NM_001647 190 557-746 CACCCCAGTTAACCTCACAG TGGAGGGAGATTAGGGTTTC APOD apolipoprotein D NM_001647 181 865-1045 TGCACCCACTCCATGTTACT TTGGAATCTACTGCGAGCAC APOL1 apolipoprotein L, 1 NM_003661 205 2268-2472 GAGAGGAGGCTTGAAGGAAC GAGAGTGGATGCTGGAAAGA APPL1 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 NM_012096 175 1744-1918 GCCATCCATAACATCTTTCG ATGTCCGAAGAACAAATCCA APPL1 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 NM_012096 209 481-689 ATGTTCCCCATTACCCAGTT TAATGCATCATGGTCTGGTG APPL1 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 NM_012096 222 5169-5390 CCTGCCACCTGAATAAAATG GGTGAAACCCCGTCTCTACT APPL1 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 NM_012096 247 3888-4134 GTGCCAAATGGGTGTAATGT TGGAACAGAAAGCTCCAGTC APTX aprataxin NM_175073 150 1550-1699 TGTAGGCATGGACAACCTTT CATGGAAGGACTGGACAAAC AR androgen receptor NM_000044 167 3285-3452 CCTGGCTTCCGCAACTTACAC GGACTTGTGCATGCGGTACTC AR-10 Androgen receptor NM_000044 163 3233-3395 TGAACTGGGAGAGAGACAGC GGAGTTGACATTGGTGAAGG AR-11 Androgen receptor NM_000044 228 1450-1677 AGGAACAGCAACCTTCACAG CCTCGCTCAGGATGTCTTTA AR-3 Androgen receptor NM_000044 195 3687-3881 TACCAGCTCACCAAGCTCCT GCTTCACTGGGTGTGGAAAT AR-4 Androgen receptor NM_000044 155 3003-3157 CGGAAGCTGAAGAAACTTGG ATGGCTTCCAGGACATTCAG AR-5 Androgen receptor NM_000044 197 899-1095 ATCTTGTCCACCGTGTGTCT TCCACCTACTTCCCTTACCC AR-6 Androgen receptor NM_000044 250 367-616 CTGCCTCAGTCGGCTACTCT GGGGAAAACAGAGGGTTCTC AR-7 Androgen receptor NM_000044 170 1020-1189 CGACTACCGCATCATCACAG TTCTGGAAAGCTCCTCGGTA AR-8 Androgen receptor NM_000044 204 1166-1369 GACCTACCGAGGAGCTTTCC CTGGGGCTAGTCTCTTGCTG AR-9 Androgen receptor NM_000044 177 2052-2228 AAGGGAGGTTACACCAAAGG CAGAGCCAGTGGAAAGTTGT ARG1 arginase, liver NM_000045 186 307-492 GGTGGCAGAAGTCAAGAAGA ACAGGTTGTCCATGCAAGTT ARG1 arginase, liver NM_000045 205 398-605 GTCCACCCTGATCTTGGAGT CCACGTCTCTCAAGCCAATA ARG1 arginase, liver NM_000045 188 516-703 AAGGAAAGATTCCCGATGTG TGTTTCTTCCATCACCTTGC ARG1 arginase, liver NM_000045 216 157-372 GGCTGGTCTGCTTGAGAAAC ATTGCCAAACTGTGGTCTCC ARG1 arginase, liver NM_000045 201 218-418 ccctttgctgacatccctaa gactccaagatcagggtgga ARG1 arginase, liver NM_000045 207 265-471 tccaaggtctgtgggaaaag ccacttgtggttgtcagtgg ARG1 arginase, liver NM_000045 223 127-349 ggtggaagaaggccctacag cagcaccaggctgattcttc ARG1 arginase, liver NM_000045 289 673-961 actaggaattggcaaggtga caaggttattgcaactgctg ARG1 arginase, liver NM_000045 257 24-280 gagagctcaagtgcagcaaa tcccacagaccttggattct ARRB1 arrestin, beta 1 NM_004041 196 706-901 AATTCTGTGCGTCTGGTCAT TCTTGTTGGTGTTGTTGGTG ARRB1 arrestin, beta 1 NM_004041 240 892-1131 CTGTCTTCACGCCCTACTCA CCATGTCAATGAGGAACCAG ARRB1 arrestin, beta 1 NM_004041 173 732-904 GGTTCAGTATGCCCCAGAGA CCGTCTTGTTGGTGTTGTTG ARRB1 arrestin, beta 1 NM_004041 155 550-704 GAGCACGCTTACCCTTTCAC CGCTTGTGGATCTTCTCCTC ARRB1 arrestin, beta 1 NM_004041 230 884-1113 CCAACAACACCAACAAGACG GTCTTCGTGCTTGAGCTTCC ARRB1 arrestin, beta 1 NM_004041 238 1321-1558 GAGAACGAGACGCCAGTAGA CCAGAACAGGAAGAAGACGA ARRB1 arrestin, beta 1 NM_004041 221 681-901 TTTGGAGGAGAAGATCCACA TCTTGTTGGTGTTGTTGGTG ARRB1 arrestin, beta 1 NM_004041 240 371-610 AGCGGAGAGTCTATGTGACG GCAGTGTCACAGAACATGGA ATF4 activating transcription factor 4 NM_001675 228 1550-1777 TGAGCCCAGAGTCCTATCTG TCTTCTGGCGGTACCTAGTG ATF4 activating transcription factor 4 NM_001675 180 1346-1525 CCCCCTTCACCTTCTTACAA AAGGGGTGTCTTCCTCCTTT ATF4 activating transcription factor 4 NM_001675 187 1653-1839 TCCCAAACCTTACGATCCTC AGCCTCGTTCTTCTTTTCCA ATG10 ATG10 autophagy related 10 homolog NM_031482 206 140-345 CCCATCATTCAGTTCCGTAG TGCACAATAACGTTGGAATG ATG10 ATG10 autophagy related 10 homolog NM_031482 247 522-768 GCTACCCTTGGATGATTGTG TTGCCCAAGTATTGGATGTT ATG10 ATG10 autophagy related 10 homolog NM_031482 157 738-894 TACGCAACAGGAACATCCAA AACAACTGGCCCTACAATGC ATG12 ATG12 autophagy related 12 homolog NM_004707 236 528-763 AACTTGTGGCCTCAGAACAG AGTCTCTTGCCACAAGCATC ATG16L1 ATG16 autophagy related 16-like 1 NM_030803 196 2584-2779 GGTTGCATGAATGTGTCTCA CCATTTCCCTGGAAAAGATT ATG16L2 ATG16 autophagy related 16-like 2 NM_033388 157 832-988 GGAAGCTTGTGAGAAGTGGA GATGATCTGGTATCGCTGCT ATG16L2 ATG16 autophagy related 16-like 2 NM_033388 163 1049-1211 TCTGAGGTCAATGCTGTTCG AGGGGTCAAAGTCCACACTG ATG16L2 ATG16 autophagy related 16-like 2 NM_033388 182 1450--1631 GTGTGGGGACCATATCATCA GGTCGATGACCTTGAGTGTG ATG2A ATG2 autophagy related 2 homolog A NM_015104 198 2148-2345 TGCTCCGACCTACATGGTAT CACTGACAGCTCCAGTTCCT ATG2A ATG2 autophagy related 2 homolog A NM_015104 193 937-1129 TCCAGCAACTTCAGGAACTG TTGAGAAGGGGGTTGGTAAG ATG2A ATG2 autophagy related 2 homolog A NM_015104 177 3325-3501 TGGAGTTCCTAGACGTGCTG TGTCCATGATGATGTTGCTG ATG2B ATG2 autophagy related 2 homolog B NM_018036 224 4092-4315 TGGAGCTGTGCACTTGATTA AACTCCAAAAGCCCCATATC ATG3 ATG3 autophagy related 3 homolog NM_022488 212 149-360 GGAAGTGGCTGAGTACCTGA GCTTATAGCACGGCACATTT ATG4A ATG4 autophagy related 4 homolog A NM_052936 193 1267-1459 GAGCAACTGGAGGAGTTTGA TGGCTCAGTCATGATTGCTA ATG4B ATG4 autophagy related 4 homolog B NM_013325 200 385-584 AGATTGGAGGTGGACACAAA ACGTATCGAAGACAGCAAGC ATG4C ATG4 autophagy related 4 homolog C NM_178221 184 1129-1312 ATTGGTGGCAAACCTAAACA TTGTACAGCTGGGATCCATT ATG4D ATG4 autophagy related 4 homolog D NM_032885 230 843-1072 GAAGGCAGGTGACTGGTATG CATACACGGGGTTGAGAGTC ATG4D ATG4 autophagy related 4 homolog D NM_032885 171 1132-1302 CCGCGACACTCACTGTACTT GGTACAGCTTGGGTCCATCT ATG4D ATG4 autophagy related 4 homolog D NM_032885 150 870-1019 GCTAGTGGCACACATCCTCA ACAGACTTCCACTCGGCTGT ATG5 ATG5 autophagy related 5 homolog NM_004849 232 2913-3144 ATGCAGGGAACACTAAGCTG TCTAGGGCATTGTAGGCTTG ATG7 ATG7 autophagy related 7 homolog NM_006395 154 1044-1197 TGTGTTGGAGATTGGTTCCT GAGATCTTGGCATTGTCCAC ATG9A ATG9 autophagy related 9 homolog A NM_001077198 250 569-818 AAAATGGCTCCCTTATCACC CGGTGGTAGATGTCCAGTTC ATG9A ATG9 autophagy related 9 homolog A NM_001077198 238 2781-3018 GACGGCTCCTCTGAGTGTTC TGCAGGGGTAGGTGTAAAGG ATG9A ATG9 autophagy related 9 homolog A NM_001077198 173 2985-3157 CCCCAGTACTGCCACCTTTA ACAGCCTGACCTGCTCATCT ATG9B ATG9 autophagy related 9 homolog B NM_173681 193 4001-4193 GCTCTGGCACAGTCAAGAAT AAGACGCTCATGAGACCAAG ATG9B ATG9 autophagy related 9 homolog B NM_173681 192 2790-2981 AGGGTTTCAGGTGACCACAG CACTTGACCCTGCACTCTGA ATG9B ATG9 autophagy related 9 homolog B NM_173681 152 3363-3514 AGGATGTCCTGCACGTTACC ATGCTCCCAACTTGACCATC ATG9B ATG9 autophagy related 9 homolog B NM_173681 237 2575-2811 CATGTCATCTACCTGCACCA GTCTGTGGTCACCTGAAACC ATG9B ATG9 autophagy related 9 homolog B NM_173681 221 3810-4030 CTCAGAATTCCATGCCCTTT CCCAAGGTGGATTCTTGACT ATG9B ATG9 autophagy related 9 homolog B NM_173681 207 800-1006 TTTGCCAACCAACCAAGTAA CTGGATGTCCCAGTAGCTGA AURKB aurora kinase B NM_004217 150 495-644 ATGACCGGAGGAGGATCTAC TCTTCCCATGGCAGTACATT AURKB aurora kinase B NM_004217 227 607-833 GGAGTTGGCAGATGCTCTAA ACCACAGATCCACCTTCTCA AURKB aurora kinase B NM_004217 187 806-992 ATGCACAATGAGAAGGTGGA TATGCCTGAGCAGTTTGGAG AURKB aurora kinase B NM_004217 218 694-911 GGGAGAGCTGAAGATTGCTG GGCGATAGGTCTCGTTGTGT AURKB aurora kinase B NM_004217 165 926-1090 GACCTAAAGTTCCCCGCTTC GACAGATTGAAGGGCAGAGG AURKB aurora kinase B NM_004217 239 332-570 GTGTACTTGGCTCGGGAGAA CAGCTCTTCTGCAGCTCCTT AURKB aurora kinase B NM_004217 155 153-307 AAGAGCCTGTCACCCCATCT AGGACGCCCAATCTCAAAGT AURKB aurora kinase B NM_004217 164 288-451 ACTTTGAGATTGGGCGTCCT GGCCTGGATTTCGATCTCTC AURKB aurora kinase B NM_004217 187 592-778 AGCCACGATCATGGAGGAGT GTAGTCCAGGGTGCCACACA AURKB aurora kinase B NM_004217 233 77-309 AACTCCTACCCCTGGCCCTA AGAGGACGCCCAATCTCAAA AXIN1 axin 1 NM_003502 164 889-1052 CTGCCGACCTTAAATGAAGA AACTCTCTGCCTTCGCTGTA AXIN1 axin 1 NM_003502 185 3197-3381 GAGTGCCTTCAACACAGCTT GTGTCATCGCATGAAAAACA AXIN1 axin 1 NM_003502 194 425-618 TGAAGTGGGCTGAGTCACTG CTTTCGGTAGATGGCTCTCG AXIN1 axin 1 NM_003502 210 2472-2681 GACAAGATCGCAGAGGAAGG ACCCCACAGTCAAACTCGTC AXIN2 axin 2 NM_004655 239 3589-3827 GGTTGATCCTGTGACTGAGG ATGAAGGTGTGTGGAGGAAA AXIN2 axin 2 NM_004655 205 590-794 AGGGAGAAATGCGTGGATAC TGGAATCAATCTGCTGCTTC AXIN2 axin 2 NM_004655 241 740-980 CCTGCCACCAAGACCTACAT CTTCATTCAAGGTGGGGAGA AXIN2 axin 2 NM_004655 250 1477-1726 GCAGATCCGAGAGGATGAAG GGAGTGGTACTGCGAATGGT BARKOR KIAA0831 NM_014924 225 2472-2696 CAGGGGAAACCATCCTACTT TCAAACTCCTGACCTCAAGC BARKOR KIAA0831 NM_014924 219 1878-2096 TGCTGAGACTGTTCCTGACA ACAGAGCGGCATGAATAAAG BARKOR KIAA0831 NM_014924 190 532-721 CAGAGGCATAATCGCAAACT TGGCACTGTCACTCTCTGAA BBC3 BCL2 binding component 3 NM_001127240 139 16-154 GGGTGAGACCCAGTAAGGAT AGCTTTCCATTCCGTTTCTT BBC3 BCL2 binding component 3 NM_001127240 227 1306-1532 GAAGAGCAAATGAGCCAAAC AACCTATGCAATGGGATTGA BBC3 BCL2 binding component 3 NM_001127240 146 707-852 ACCTCAACGCACAGTACGAG CACCTAATTGGGCTCCATCT BBC3 BCL2 binding component 3 NM_001127240 130 1546-1675 TGTGACCACTGGCATTCATT TCCTCCCTCTTCCGAGATTT BCL11B B-cell CLL/lymphoma 11B NM_138576 192 6627-6818 GTGGTGGTCTTTTGGATGAG AGTGGCAAGGAGGAAAGAGT BCL11B B-cell CLL/lymphoma 11B NM_138576 288 3704-3991 AAGGGAAACCTTGAGTGGTG AAGCCAGAAAACGCCTAAAA BCL11B B-cell CLL/lymphoma 11B NM_138576 261 6993-7253 GTGCTCACCAGCTTACCAGA CCCCATGAAAGACCCTCTAA BCL2 bcl2 NM_000633 TCCGCATCAGGAAGGCTAGA AGGACCAGGCCTCCAAGCT BECN1 beclin 1, autophagy related NM_003766 200 817-1016 GCTGAGAGACTGGATCAGGA ATTGTGCCAAACTGTCCACT BECN1L1 Beclin-1-like protein 1 XM_939982 153 790-942 TTGGGCGTCATCAATAACTT GGGGATGAGTCGATACCTCT BECN1L1 Beclin-1-like protein 1 XM_939982 221 344-564 ATCCCCTGTGTGAAGAATGC TGCATTGTTCCTGTCCACAT BECN1L1 Beclin-1-like protein 1 XM_939982 216 888-1103 CCTTACCCTGGCCAATACAA CCCTTCTCAGCCTCTTCCTT BECN1L1 Bcl-2-interacting protein beclin XM_001727013 153 789-941 TTGGGCGTCATCAATAACTT GGGGATGAGTCGATACCTCT BECN1L1 Bcl-2-interacting protein beclin XM_001727013 166 1077-1242 CAGTTCAAGGAAGAGGCTGA GCATGAACTTGAGTGCCTTT BECN1L1 Bcl-2-interacting protein beclin XM_001727013 221 343-563 ATCCCCTGTGTGAAGAATGC TGCATTGTTCCTGTCCACAT BGLAP bone gamma-carboxyglutamate (gla) protein NM_199173 232 165-396 CAGGCGCTACCTGTATCAAT CAAGGGGAAGAGGAAAGAAG BGLAP bone gamma-carboxyglutamate (gla) protein NM_199173 233 19-251 ATGAGAGCCCTCACACTCCT GGATTGAGCTCACACACCTC BGLAP bone gamma-carboxyglutamate (gla) protein NM_199173 230 142-371 GGCAGCGAGGTAGTGAAGAG CTGGAGAGGAGCAGAACTGG BGLAP bone gamma-carboxyglutamate (gla) protein NM_199173 175 98-272 GTGCAGAGTCCAGCAAAGGT TCAGCCAACTCGTCACAGTC BGLAP bone gamma-carboxyglutamate (gla) protein NM_199173 151 18-168 CATGAGAGCCCTCACACTC CCTGGGTCTCTTCACTACCT BGLAP-6 bone gamma-carboxyglutamate (gla) protein NM_199173 210 218-427 ccaggcgctacctgtatcaa gcctggagaggagcagaact BGLAP-7 bone gamma-carboxyglutamate (gla) protein NM_199173 157 176-332 cctttgtgtccaagcaggag atgtggtcagccaactcgtc BIN3 bridging integrator 3 NM_018688 198 48-245 AGAAACGAGTTGTGGCTGAG CGGTGCTCTTCTTCATGTCT BIN3 bridging integrator 3 NM_018688 184 703-886 CCGAGCTCAGGTTGTGTACT CAGGAGTCCTCCAAGAGTGA BIN3 bridging integrator 3 NM_018688 244 870-1113 CTCTTGGAGGACTCCTGTGA TGGACGGTTCTCCAAATAAA BIRC4-1 Baculoviral IAP repeat-containing 4 NM_001167 150 654-803 TATGCTCACCTAACCCCAAG AGGAAAGTGTCGCCTGTGT BLM Bloom syndrome NM_000057 183 2581-2763 TCTTACGGCCACAGCTAATC TCATATGGGTGGTGCTTTCT BMP1 bone morphogenetic protein 1 NM_001199 207 1163-1369 CTATGTGGAGGTCCGAGATG TGAATGTGGCCATAGTCCTT BMP1 bone morphogenetic protein 1 NM_001199 150 NYO GTACAGCAGGCTGTGGATCT ACGGGATCTACCTCTCCATC BMP1 bone morphogenetic protein 1 NM_001199 GTGCCTACGACCACCTAGAG CCTTTCGCTGGACCGAGTTAT BMP2 bmp2 NM_001200 195 ATGGATTCGTGGTGGAAGT GCTGTTTGTGTTTGGCTTG BMP4 bmp4 NM_001202 182 CTGACCACCTCAACTCAACC CCCACATCCCTCTACTACCA BMPR1A bone morphogenetic protein receptor, type IA NM_004329 188 1101-1288 AGCAGACGTCGTTACAATCG TCTCCATATCGGCCTTTACC BMPR1A bone morphogenetic protein receptor, type IA NM_004329 169 1398-1566 CGCCATGAAAACATACTTGG AGGCAGCTGAATAAGCCAAT BMPR1A bone morphogenetic protein receptor, type IA NM_004329 214 1807-2020 ACCACTTCCAGCCCTACATC TCATCACTGTTCCACCGATT BNIP3L BCL2/adenovirus E1B 19kDa interacting protein 3-like NM_004331 230 174-403 ACAACTGCGAGGAAAATGAG ACAGTGAGAACTGCCTCTGG BNIP3L BCL2/adenovirus E1B 19kDa interacting protein 3-like NM_004331 190 461-650 AGCAGGGACCATAGCTCTCA TCATGGCTCCACTTTTCCTC BNIP3L BCL2/adenovirus E1B 19kDa interacting protein 3-like NM_004331 175 3060-3234 ATTGTGGTTTGGAAAGGAGA TGTGCAGTTTTGCTCTTGAT BRAF-2 V-raf murine sarcoma viral oncogene homolog B1 NM_004333 184 2173-2356 ACCACTCTTTCCCCAAATTC GACAGGAAACGCACCATATC BRAF-3 V-raf murine sarcoma viral oncogene homolog B1 NM_004333 199 1397-1595 TCGAGTGATGATTGGGAGAT TCACATGTCGTGTTTTCCTG BRAF-4 V-raf murine sarcoma viral oncogene homolog B1 NM_004333 216 951-1166 ACCACCCAATACCACAGGAA CATTGGGAGCTGATGAGGAT BSG basigin (Ok blood group) NM_001728 214 658-871 AAACGGAGTTCAAGGTGGAC ATCTTGTACCAGGCCCAGTC BSG basigin (Ok blood group) NM_001728 209 493-701 CAGTCGTGCTAGTCCTGGAA GTACTCTCCCCACTGGTCGT BSG basigin (Ok blood group) NM_001728 172 1629-1800 CTGTCTGAAGCCAATGCTGT GGAGTGACTTGAGGCTGTGA BSG basigin (Ok blood group) NM_001728 245 1406-1650 GGGTTTTCTCCATTCAGGAT AGACAGCATTGGCTTCAGAC BTBD12 BTB (POZ) domain containing 12 NM_032444 196 5344-5539 GTGCTGAAGAAGGAACTGGA TTGAAGGCTTGTAGGTCTGG BTBD12 BTB (POZ) domain containing 12 NM_032444 241 725-965 ACCAGCCTGAAAGCCTTAAA GACGGAGGTTTCTTCTCTGC BTBD12 BTB (POZ) domain containing 12 NM_032444 250 1348-1597 GTCCCAAAGGATCCTCAAGA TTTCAGCTTCATCCAAGCAC BXDC2 brix domain containing 2 NM_018321 192 751-942 ATTTTCCAGGGAAGTTTTGG AACATCTGCAGTGGGATCAT BXDC2 brix domain containing 2 NM_018321 224 597-820 ACCACGGTATCATCCCAAAA GATGCATGTTTGGTGACTGG BXDC2 brix domain containing 2 NM_018321 242 833-1074 GATCCATCACAGCTGCAAAA CCCACTGTCCATCCTCTGTT BYSL bystin-like NM_004053 157 1109-1265 TACGAGATGACGTTGCTGAA CTACCCACAATGATGGCTTC C10ORF116 chromosome 10 open reading frame 116 NM_006829 191 293-483 AGGCCTCTGACACCTTCTCT ATTTTAATGAGGGGGCAGAC C10ORF116 chromosome 10 open reading frame 116 NM_006829 233 93-325 ACTCCACAGATACCCCGAAG TTTTCCCAATCCCAGAGAAG C15orf48 chromosome 15 open reading frame 48 NM_197955 126 120-245 TGAGCTTTTTCCAACTCCTG CAAGGATCACATCGGTTTTC C15orf48 chromosome 15 open reading frame 48 NM_197955 184 150-333 AGGAACTCATTCCCTTGGTG ATGGGTTTCCATTGTTGGTT C15orf48 chromosome 15 open reading frame 48 NM_197955 188 355-542 AAGGGTGACCAAATGACGAG TGCAGTTATTGCTGCACTCC C16orf75 chromosome 16 open reading frame 75 NM_152308 154 710-863 TTCCTTCCTGGTTTGTGTGT ATGGGCAATGACCGTACTTA C16orf75 chromosome 16 open reading frame 75 NM_152308 165 1054-1218 AGACGCAGCTCTATCCCTTT GTCTCGCCGAAAGTTATGAA C16orf75 chromosome 16 open reading frame 75 NM_152308 229 594-822 ACCAAGGAGTCCGGATGTAG GACGCAGCAGTAATGGAAAA C20orf118 chromosome 20 open reading frame 118 NM_080628 179 81-259 AACGAAGAGGAAGAGGAGGA GACGTGCAGAAGACCAGACT C20orf118 chromosome 20 open reading frame 118 NM_080628 217 208-424 ACTTCCCACCAAGAGTCACC AAGAGGAATGTCTCGCCAGT C20orf118 chromosome 20 open reading frame 118 NM_080628 C20orf118 chromosome 20 open reading frame 118 NM_080628 C20orf74 chromosome 20 open reading frame 74 NM_020343 199 2636-2834 GCAGCAGACACAAGGAAAAT ATCGGTGGGACTCAGTTGTA C6orf64 chromosome 6 open reading frame 64 NM_018322 154 449-602 GCGCCTACTCTGTGTTCAAT GGTGAGGAAGACCACATCAG CACNA1C calcium channel, voltage-dependent, L type, alpha 1C subunit NM_000719 220 11018-11237 CAGAGGCTACGATTTGAGGA GCTTCACAAAGAGGTCGTGT CACNA1C calcium channel, voltage-dependent, L type, alpha 1C subunit NM_000719 277 CTGTTCTCGTGACCTGGAGT AAGACACCCGTTTGCTGTAG CACNA1G calcium channel, voltage-dependent, T type, alpha 1G subunit NM_198397 170 4910-5079 CTTCACACCCTCTGCTGTCT CTGCTCCACCATGTAGCTCT CACNA1G calcium channel, voltage-dependent, T type, alpha 1G subunit NM_198397 190 CATCCTGGTCAACACACTCA CACAATGACACCATCGAAGA CACNG6 calcium channel, voltage-dependent, gamma subunit 6 NM_145814 225 1515-1739 TGTCCCCTTATCCTTTCTCC CAAGTGAATCGATCCAGACC CACNG6 calcium channel, voltage-dependent, gamma subunit 6 NM_145814 240 52-291 CCTCCAAACACACACAGGAC CCCACCCTGAGGTTTAGAGA CACNG6 calcium channel, voltage-dependent, gamma subunit 6 NM_145814 195 608-802 CTTCCTGCAAGAGGAGAACC TTGGCCTTGTAGGTGTTGAG CACNG6 calcium channel, voltage-dependent, gamma subunit 6 NM_145814 212 222-433 CATTCCTCTGGAGCTCTTGG ATGCGAAAGTCGAGATTGCT CACNG6 calcium channel, voltage-dependent, gamma subunit 6 NM_145814 168 1407-1574 AGCCCTTTGACCTTCTCCAT CAACCCACATACAGCCACAG CACNG6 calcium channel, voltage-dependent, gamma subunit 6 NM_145814 161 1298-1458 CTGCTTTCTGCTGCTCACAC AGGAGATGGGGCAAAAAGAT CADM1 cell adhesion molecule 1 NM_014333 185 2976-3160 CTCGGGAAAAGGTAGAGGAG TTTTGATGCCATCTTTCCAT CALCA calcitonin-related polypeptide alpha NM_001741 153 532-684 CATGTGGTTTGGTTCCTCTC GGCCCTCATTTTCTGGTATT CALM calmodulin 1 NM_006888 246 2428-2673 GCTAGCAAGGCAGTGAGAAG AAAGCCAACCCTTAGCTCAT CALM calmodulin 1 NM_006888 151 240-390 TCAAGGAAGCCTTCTCCCTA GTGCCATTACCATCAGCATC CALM calmodulin 1 NM_006888 162 932-993 GTGGTCCTGTCCCCTAAAGA ACTGTGCTCAATCGTCAAGC CAMP (LL37) cathelicidin antimicrobial peptide NM_004345 183 297-479 GCTAACCTCTACCGCCTCCT GGTCACTGTCCCCATACACC CAMP (LL37) cathelicidin antimicrobial peptide NM_004345 201 116-316 CTAGAGGGAGGCAGACATGG AGGAGGCGGTAGAGGTTAGC CAMP (LL37) cathelicidin antimicrobial peptide NM_004345 247 298-544 CTAACCTCTACCGCCTCCTG AGCAGGGCAAATCTCTTGTT CAMP (LL37) cathelicidin antimicrobial peptide NM_004345 201 495-695 GGCTCCTTTGACATCAGTTG ATTTCTCAGAGCCCAGAAGC CAMP (LL37) cathelicidin antimicrobial peptide NM_004345 157 409-565 CACAGCAGTCACCAGAGGAT GATTTCCGGAAGAAATCACC CAMP (LL37) cathelicidin antimicrobial peptide NM_004345 142 287-428 GTCCTCGGATGCTAACCTCT ATCCTCTGGTGACTGCTGTG CAMP (LL37) cathelicidin antimicrobial peptide NM_004345 239 141-379 ATGAAGACCCAAAGGGATGG GTGAAGCTCACAGGCTTTGG CAMP (LL37) cathelicidin antimicrobial peptide NM_004345 212 459-670 CGGTGTATGGGGACAGTGAC CCAGGGTAGGGCACACACTA CAMP (LL37) cathelicidin antimicrobial peptide NM_004345 186 127-312 CAGACATGGGGACCATGAAG GGCGGTAGAGGTTAGCATCC CAMP (LL37) cathelicidin antimicrobial peptide NM_004345 241 410-650 ACAGCAGTCACCAGAGGATT GGACTCTGTCCTGGGTACAA CAMP (LL37) cathelicidin antimicrobial peptide NM_004345 201 231-431 CAGGTCCTCAGCTACAAGGA ACAATCCTCTGGTGACTGCT CAMP (LL37) cathelicidin antimicrobial peptide NM_004345 158 290-447 CTCGGATGCTAACCTCTACC CGTCCTTCTTGAAGTCACAA CANX calnexin NM_001746 179 1081-1259 GATGACTGGGATGAAGATGC TCACATCTAGGGTTGGCAAT CANX calnexin NM_001746 225 3158-3382 GTGGGAGGAGTGACATGAAG TGTGGGAGAGGCTCTGATAG CANX calnexin NM_001746 210 508-717 GAGTCAAAGCTTCCAGGTGA ATGGAACTGATCCAGGTTGA CAPN6 calpain 6 NM_014289 169 286-454 TTCTACAACCGACTGCTTCC GAGACTCCTGAACAGCCAAA CAPRIN2 caprin family member 2 NM_001002259 280 2010-2289 TTAAGTCCTGGGAGGCTTCT TTTGGAGTTTGCTTCTTTGG CAPRIN2 caprin family member 2 NM_001002259 219 2386-2584 TCAAAACAGCCAGAGACTCC CTTCGGAAGGGTAGAGGAAG CAPRIN2 caprin family member 2 NM_001002259 145 3594-3738 GCAGCCCAGAAAGAGACAAC ATCTGCTGAGGCAGAGGGTA CASC5 cancer susceptibility candidate 5 NM_170589 127 1880-2006 acagcagagcctgtcaaatc tgcaagaggaacctgacttc CASP3-1 Caspase 3, apoptosis-related cysteine peptidase NM_004346 198 CACAGCAAAAGGAGCAGTTT CTCAATGCCACAGTCCAGTT CASP9-1 Caspase 9, apoptosis-related cysteine peptidase NM_001229 247 CATTGGTTCTGGAGGATTTG CATTTTCTTGGCAGTCAGGT CAT catalase NM_001752 200 634-833 ACTTCTGGAGCCTACGTCCT CGCATCTTCAACAGAAAGGT CAV1 caveolin 1, caveolae protein, 22kDa NM_001753 182 1756-1937 CCTGCCTCTCATCAACTGAA AATGGCCTCCATTTTACAGC CAV1 caveolin 1, caveolae protein, 22kDa NM_001753 227 654-880 CACATCTGGGCAGTTGTACC GAAATTGGCACCAGGAAAAT CAV2 Caveolin 2 (CAV2) NM_001233 223 TGTAAAGACCTGCCTAATGG GGAAATGAACAGAACAGTGG CCL3 chemokine (C-C motif) ligand 3 NM_002983 215 93-307 GCTCAGAATCATGCAGGTCT TTCGCTTGGTTAGGAAGATG CCL3 chemokine (C-C motif) ligand 3 NM_002983 162 #3 GTGTGACCTCCACAGCTACC GGGAACTCTCAGAGCAAACA CCL3 chemokine (C-C motif) ligand 3 NM_002983 AGTTCTCTGCATCACTTGCTG CGGCTTCGCTTGGTTAGGAA CCL3 chemokine (C-C motif) ligand 3 NM_002983 198 154-351 TGCAACCAGTTCTCTGCATC TTTCTGGACCCACTCCTCAC CCL3 chemokine (C-C motif) ligand 3 NM_002983 197 289-485 ATCTTCCTAACCAAGCGAAG GAAGAGGTAGCTGTGGAGGT CCL5-3 Chemokine (C-C motif) ligand 5 NM_002985 208 101-308 CCTCATTGCTACTGCCCTCT CCATTTCTTCTCTGGGTTGG CCL5-4 Chemokine (C-C motif) ligand 5 NM_002985 168 247-414 CAGCAGTCGTCTTTGTCACC TCCCAAGCTAGGACAAGAGC CCL5-5 Chemokine (C-C motif) ligand 5 NM_002985 171 13-183 TCCTGCAGAGGATCAAGACA CAATGTAGGCAAAGCAGCAG CCND1 Cyclin D1 NM_053056 166 AACAGATCATCCGCAAACAC GTGAGGCGGTAGTAGGACAG CCND1-2 Cyclin D1 NM_053056 221 342-562 TTCAAATGTGTGCAGAAGGA GGGATGGTCTCCTTCATCTT CCND1-3 Cyclin D1 NM_053056 174 2460-2633 TTCACACCGGAAGGTTTTTA AAAGGCAGAAGGTTTGTGTG CCND1-4 Cyclin D1 NM_053056 236 1029-1264 GAGGAAGAGGAGGAGGAGGA GAGATGGAAGGGGGAAAGAG CCNT2 cyclin T2 NM_058241 100 2035-2134 CTCCTCCCCCTGTCACATAC TGATTGGCATCAGGACCGTTG CD24 CD24 molecule NM_013230 200 1985-2184 ATGGGAACAAACAGATCGAA TTTGCTCTTTCAGCCATTTC CD24 CD24 molecule NM_013230 238 165-402 CTCCTACCCACGCAGATTTA GGGTTTAGAAGATGGGGAAA CD24 CD24 molecule NM_013230 168 803-970 TGAGAAGGAACTTCCAGGTG CAAATGCAATGTCAAATCCA CD34-1 CD34 antigen NM_001025109.1 159 CTTTGCTTGCTGAGTTTGCT CAGGCTGGTACTTCCAAGG CD36 CD36 molecule NM_001001548 227 365-591 GTTTGCAAGAAACAGGTGCT TGTGCCTGTTTTAACCCAAT CD47 CD47 molecule NM_001777 185 1467-1651 GCCTCTGGCCTCTAGGTAAC AAGTGGCAGACACCTCTCAG CD47 CD47 molecule NM_001777 233 886-1118 TCCTTCGTCATTGCCATATT AATGCATTAAGGGGTTCCTC CD47 CD47 molecule NM_001777 197 4865-5061 TGTGCAAGATCCTCTCTTGG TACCTTGGCAAAGATTGCAG CD68 CD68 molecule NM_001251 159 505-663 CAACTGCCACTCACAGTCCT CAATGGTCTCCTTGGAGGTT CD68 CD68 molecule NM_001251 183 1150-1332 TCTTGCTGCCTCTCATCATC TTGCGTGTCGAGGAAATAAG CD68 CD68 molecule NM_001251 245 1574-1818 GAGGCAGAACTGCTTGAACC GGAAAACCCCGTCAAAGATT CD81 CD81 molecule NM_004356 246 366-611 CTGTATCTGGAGCTGGGAGA GAACTGCTTCACATCCTTGG CD81 CD81 molecule NM_004356 179 768-946 AGCAACATCATCAGCAACCT CCTCAGTACACGGAGCTGTT CD81 CD81 molecule NM_004356 172 712-883 GCACACTGACTGCTTTGACC ATCATGATCACAGCGACCAC CD81 CD81 molecule NM_004356 152 1126-1277 GTCACATGTAGGTGGCGTGT GTTGGCCAAGCTGAGTCTCT CD9 CD9 molecule NM_001769 226 192-417 TGTCCTTGCCATTGGACTAT AATGGCGAATATCACCAAGA CD9 CD9 molecule NM_001769 166 399-564 CTTGGTGATATTCGCCATTG GTTCAACGCATAGTGGATGG CD9 CD9 molecule NM_001769 230 437-666 GGGGATATTCCCACAAGGAT GATGGCATCAGGACAGGACT CD9 CD9 molecule NM_001769 226 192-417 TGTCCTTGCCATTGGACTAT AATGGCGAATATCACCAAGA CD9 CD9 molecule NM_001769 236 398-633 TCTTGGTGATATTCGCCATT TTCGAGTACGTCCTTCTTGG CD9 CD9 molecule NM_001769 230 437-666 GGGGATATTCCCACAAGGAT GATGGCATCAGGACAGGACT CDC25B cell division cycle 25 homolog B NM_021873 151 1861-2011 GGAGGCTGAGGAACCTAAAG GTCTTGGTGCTTTCCGTCTA CDC25B cell division cycle 25 homolog B NM_021873 214 3435-3648 AGCGTTTTGTTGAGCATGAC AACCAAGGCCCTAACAGATG CDC25B cell division cycle 25 homolog B NM_021873 248 2128-2375 CATCAAGACTGCGGTGAACT GCTGAGGGAAGAACTCCTTG CDC25B cell division cycle 25 homolog B NM_021873 180 1533-1712 CCCTAGGTCGCTTCTCTCTG ACATGACGAGGTCCTTTTCC CDH1 cadherin 1, type 1, E-cadherin NM_004360 186 2165-2350 TTAGAGGTCAGCGTGTGTGA CAGTAAGGGCTCTTTGACCA CDH1-3 cadherin 1, type 1, E-cadherin NM_004360 196 1235-1430 AATCCTCCGATCTTCAATCC AAATGCCATCGTTGTTCACT CDH1-4 cadherin 1, type 1, E-cadherin NM_004360 192 3329-3520 CAAGCTATCCTTGCACCTCA TGCAGTGGCTCATGTCTGTA CDH3 cadherin 3, type 1, P-cadherin NM_001793 202 787-988 AAGATCTTCCCATCCAAACG CTACAGCGAAGACACCCTCA CDH3 cadherin 3, type 1, P-cadherin NM_001793 226 535-760 TCTCTCCTCCTTCTCCAGGT TTCTTTCCTGGACTGTCTCG CDKN1A Cyclin-dependent kinase inhibitor 1A (p21, Cip1) NM_000389 220 1096-1315 AAACTTTGGAGTCCCCTCAC AAAGGCTCAACACTGAGACG CDKN1A Cyclin-dependent kinase inhibitor 1A (p21, Cip1) NM_000389 172 417-588 AAGACCATGTGGACCTGTCA TAGGGCTTCCTCTTGGAGAA CDKN1A Cyclin-dependent kinase inhibitor 1A (p21, Cip1) NM_000389 174 990-1163 ATGAAATTCACCCCCTTTCC CCCTAGGCTGTGCTCACTTC CDKN1B-2 cyclin-dependent kinase inhibitor 1B NM_004064 225 476-700 TCAAACGTGCGAGTGTCTAA CCACTCGTACTTGCCCTCTA CDKN1B-3 cyclin-dependent kinase inhibitor 1B NM_004064 204 1166-1369 GCTGACTTCATGGAATGGAC CCCTTCCCCAAAGTTTATGT CDKN1B-4 cyclin-dependent kinase inhibitor 1B NM_004064 154 1477-1630 GGGAAGGGTTTGAATTGTTT CACCAGATCTCCCAAATGAG CDKN2A-3 cyclin-dependent kinase inhibitor 2A NM_000077 118 848-965 CTTCCCCCACTACCGTAAAT TGCTCACTCCAGAAAACTCC CDKN2A-4 cyclin-dependent kinase inhibitor 2A NM_000077 132 981-1112 CACATTCATGTGGGCATTTC GCCATTTGCTAGCAGTGTGA CDKN2A-5 cyclin-dependent kinase inhibitor 2A NM_000077 145 847-991 CCTTCCCCCACTACCGTAAA ACATGAATGTGCGCTTAGGG CDKN2AIP CDKN2A interacting protein NM_017632 200 875-1074 AACACGGTTCTGCATCATTT TGGCAATTCTACCTCTGAGC CDKN2AIP CDKN2A interacting protein NM_017632 212 482-693 TCAAAGTGACAGATGCTCCA CGTTGAACTGTTTTCCTGCT CDKN2AIP CDKN2A interacting protein NM_017632 232 529-760 GCCAAGGTGAAGAAAAGAGG TCTGACTGGAGATGCCAGAG CDKN2AIP CDKN2A interacting protein NM_017632 213 1525-1737 GGTGGCTTTAGTCCCAATGT TGCTTTTGCATTTTCTTTGC CDX2 caudal type homeobox 2 NM_001265 276 1235-1510 TGGCTCTCAGAGGAAAAATG TTTCCCTTGAGTCCCTCTCT CDX2 caudal type homeobox 2 NM_001265 179 1775-1953 CCCGAACAGGGACTTGTTTA AGACCAACAACCCAAACAGC CDX2 caudal type homeobox 2 NM_001265 224 1811-2034 AGCTTCTCTGGGCTGAATGT TACTCCCCACTTCCCTTCAC CEACAM1-2 carcinoembryonic antigen-related cell adhesion molecule 1 NM_001712 180 1139-1318 CTCTGTGAACCTGACCTGCT ATTGGGTTGAAGACCTCACA CEACAM1-3 carcinoembryonic antigen-related cell adhesion molecule 1 NM_001712 213 2385-2597 ATTCCTGATGGAAAATGCAA ATCCCAATACCCCAAATTGT CEACAM1-4 carcinoembryonic antigen-related cell adhesion molecule 1 NM_001712 175 2230-2404 CACACCTTTGTCCACTGTCA TTGCATTTTCCATCAGGAAT CEBPB-1 CCAAT/enhancer binding protein (C/EBP), beta NM_005194 152 1002-1153 GCACAGCGACGAGTACAAG GCTGCTCCACCTTCTTCTG CEBPB-2 CCAAT/enhancer binding protein (C/EBP), beta NM_005194 283 280-563 TTCTACTACGAGGCGGACTG AGAAGAGGTCGGAGAGGAAG CEBPB-3 CCAAT/enhancer binding protein (C/EBP), beta NM_005194 164 412-577 ATCGACTTCAGCCCGTACC CCGTAGTCGTCGGAGAAGAG CEBPB-4 CCAAT/enhancer binding protein (C/EBP), beta NM_005194 173 1498-1670 AACTCTCTGCTTCTCCCTCTG AAGCCCGTAGGAACATCTTT CEBPB-5 CCAAT/enhancer binding protein (C/EBP), beta NM_005194 290 865-1155 CTCTCCACGTCCTCCTCGTC AGCTGCTCCACCTTCTTCTG CETN2 centrin, EF-hand protein, 2 NM_004344 170 794-963 ACACAAGCGTGAAGAAAAGG TAAAAACTGGAGCCGTCAAG CETP cholesteryl ester transfer protein, plasma NM_000078 246 883-1128 CGCATGCTGTACTTCTGGTT GACCACGACTCCCTTGTTTT CETP cholesteryl ester transfer protein, plasma NM_000078 164 643-806 CTGAAGGGACAGATCTGCAA TTGTGATGGGACTCCAGGTA CETP cholesteryl ester transfer protein, plasma NM_000078 245 788-1035 ACCTGGAGTCCCATCACAAG TTGGAAGATTTCCTGGTTGG CFD complement factor D NM_001928 153 957-1109 TAGCGCGACTCCATCTCTAC GTGCAATCACAACTCACTGC CFD complement factor D NM_001928 226 825-1050 AAAGTCCCGAGCAATGAAGT GCCTCCTGAGTAGCTGGAAC CFD complement factor D NM_001928 CFD complement factor D NM_001928 CGB chorionic gonadotropin, beta polypeptide 8 NM_033183 153 235-387 CCTGGCCTTGTCTACCTCTT CTGGAACATCTCCATCCTTG CGB chorionic gonadotropin, beta polypeptide 8 NM_033183 158 1-158 GCTTCAGTCCAGCACCTTTC CACGGTGAAGTGACCTCAGA CGB chorionic gonadotropin, beta polypeptide 8 NM_033183 172 126-297 CGACGACTGAGTCTCTGAGG TGTAGGATGCTGGAGTGAGC CHAF1A chromatin assembly factor 1, subunit A NM_005483 170 1868-2037 GACACGAAGCTCCTGGACTA CCTTCGTCCTCAGACAGGTA CHRNA10 cholinergic receptor, nicotinic, alpha 10 NM_020402 150 1570-1719 CAAGGGAGCACTCATTGTCT CTCCAATACCCAGCACAAAC CHRNA10 cholinergic receptor, nicotinic, alpha 10 NM_020402 186 167-352 AGCTGTTCCGTGACCTCTTT CCCATCGTAGGTAGGCATCT CHRNA10 cholinergic receptor, nicotinic, alpha 10 NM_020402 228 1149-1376 GTCCAGGCCACCTGAGTTAT AAGAAGATGGCCAGGAAGAA CHRNA1-3 Cholinergic receptor, nicotinic, alpha 1 (muscle) NM_001039523 192 282-473 GATCGTGACAACCAATGTGC CGCCAGATCTTTTCTGAAGG CHRNA1-4 Cholinergic receptor, nicotinic, alpha 1 (muscle) NM_001039523 243 384-626 TGAGCAATGGGTGGATTACA TCAAAGGGAAAGTGGGTGAC CHRNA1-5 Cholinergic receptor, nicotinic, alpha 1 (muscle) NM_001039523 154 1413-1566 gtacgttgcaatggtgatgg taggttccagggcagagcta CHRNA1-6 Cholinergic receptor, nicotinic, alpha 1 (muscle) NM_001039523 209 905-1113 tggtattctacctgcccaca gtggtgtgtgttgatgacga CHRNA3-2 Cholinergic receptor, nicotinic, alpha 3 NM_000743 163 490-652 gactatggtggggcagagtt taaagatggccggaggtatc CHRNA3-3 Cholinergic receptor, nicotinic, alpha 3 NM_000743 206 1472-1677 atgctgtgctgtccctctct ttgcagaaacaatcctgctg CHRNA4-4 Cholinergic receptor, nicotinic, alpha 4 NM_000744 221 4550-4770 acgaccttcgaggagtcaga ctaatcaccgacagctgcaa CHRNA4-5 Cholinergic receptor, nicotinic, alpha 4 NM_000744 172 2168-2339 cacgtttgccaaattttcct ccgagtcctgcaggtagaag CHRNA9 cholinergic receptor, nicotinic, beta 3 NM_000749 217 447-663 TCAGAATCTCTGTGGCTTCC TGCCATCATAAGTCCAGGAT CHRNA9 cholinergic receptor, nicotinic, beta 3 NM_000749 153 1169-1321 TTGCATGAAAGATCATGTGG GAATCAGCAGCTTTTTCCAA CHRNA9 cholinergic receptor, nicotinic, beta 3 NM_000749 195 799-993 CGTATTCCTTCGTCCTGAGA ACGATGGGATGATTTCTTCA CHRNB3 cholinergic receptor, nicotinic, beta 3 NM_000749 153 1169-1321 TTGCATGAAAGATCATGTGG GAATCAGCAGCTTTTTCCAA CHRNB3 cholinergic receptor, nicotinic, beta 3 NM_000749 224 1607-1830 CGTTGTCTTTGTGGAAATGG GAGGTGTTCCTCCACCAAGT CHRNB3 cholinergic receptor, nicotinic, beta 3 NM_000749 190 374-563 ACAGGAATGGACAGACCACA AGGGGTCCAGACAACAGTTC CHST4 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4 NM_005769 178 1636-1813 GAGGCCTATTAAGCACGACA ACCTTGTTCCCACTTCCTTC CIRBP Cold inducible RNA binding protein NM_001280 178 153-330 GCATCAGATGAAGGCAAACT TAGCGTCGTCAATGTTCTCA CIRBP Cold inducible RNA binding protein NM_001280 159 573-731 TATAGCAGCCGGAGTCAGAG CGAAGCTCCCACAATCTTTA CIRBP Cold inducible RNA binding protein NM_001280 245 1118-1362 CAACTCCGTGTGACGTTTCT GCCAAAGAAAACTGCGTACA CKMT1B creatine kinase, mitochondrial 1B NM_020990 160 23-182 CTCCAGCACAGGAACTAGGA CAGATGTGTTTGCTGCTCAC CLDN1 claudin 1 NM_021101 174 701-874 TTTGGTCAGGCTCTCTTCAC TCTCCTTTTGCCTCTGTGTC CLDN1 claudin 1 NM_021101 160 545-704 GAAGACGATGAGGTGCAGAA CAAATTCGTACCTGGCATTG CLDN1 claudin 1 NM_021101 111 590-700 GCGCGATATTTCTTCTTGCAGG TTCGTACCTGGCATTGACTGG CLDN2 claudin 2 NM_020384 92 599-690 CTCCCTGGCCTGCATTATCTC ACCTGCTACCGCCACTCTGT CLDN3 claudin 3 NM_001306 CTGCTCTGCTGCTCGTGTCC TTAGACGTAGTCCTTGCGGTCGTAG CLDN4 claudin 4 BT006989 159 251-409 TCATCATCAGCATCATCGTG ACACCGGCACTATCACCATA CLDN4 claudin 4 BT006989 201 7-207 TCCATGGGGCTACAGGTAAT CGAGTCGTACACCTTGCACT CLDN4 claudin 4 BT006989 GGCTGCTTTGCTGCAACTGTC GAGCCGTGGCACCTTACACG CLDN6 claudin 6 NM_021195 198 803-1000 ACCTTTTGTTTCTGCCTCCT TCCATAGCTTGACTGGCTTC CLDN6 claudin 6 NM_021195 163 903-1065 TCTGCTGTTTCTCACCCTTG CAGGAACTCTTGGGGACAGT CLDN6 claudin 6 NM_021195 190 690-879 GCCCTCTGAGTACCCTACCA CACCTTGGCTCAGTTTTCAA COL1A1 Collagen, type I, alpha 1 NM_000088 191 922-1112 GGACACAGAGGTTTCAGTGG CCAGTAGCACCATCATTTCC COL1A1 Collagen, type I, alpha 1 NM_000088 221 4916-5136 CCACTCCTTCCCAAATCTGT AAAACGAAGGGGAGATGTTG COL1A1 Collagen, type I, alpha 1 NM_000088 250 3841-4090 AGCCAGCAGATCGAGAACAT TCTTGTCCTTGGGGTTCTTG COL1A2 collagen, type I, alpha 2 NM_000089 162 4018-4179 AACCAAGGATGCACTATGGA GCTGCCAGCATTGATAGTTT COL1A2 collagen, type I, alpha 2 NM_000089 196 525-722 CCTAGCAACATGCCAATCTT TCCATCATACTGAGCAGCAA COL4A1 collagen, type IV, alpha 1 NM_001845 161 5463-5623 TCCATACTGTTTGCCCATTT TCCATTTGGAGGTTCAAAAA COL4A1 collagen, type IV, alpha 1 NM_001845 174 849-1022 CCAGGACAAGCTCAAGTTCA ACTCCCTTTTTCCCCTTTGT COL4A1 collagen, type IV, alpha 1 NM_001845 238 3676-3913 AAGGTTCAAAGGGTGAGGTG ACTCCATCAATCCCAGGAAG COL4A1 collagen, type IV, alpha 1 NM_001845 229 4333-4561 CTGGCCAGAAAGGAGAGATG TCATTGCCTTGCACGTAGAG COL4A1 collagen, type IV, alpha 1 NM_001845 228 4731-4958 ACGGGGGAAAACATAAGACC TGGCGCACTTCTAAACTCCT COL4A1 collagen, type IV, alpha 1 NM_001845 224 3226-3449 GTTCACCTGGCTTACCTGGA TCCTGGATAGCCAACACTCC COMMD3 COMM domain containing 3 NM_012071 167 514-680 CAGAACACTGATTCCCCATC TCTGGTTTTCCTCTGCACTC COMMD3 COMM domain containing 3 NM_012071 229 49-277 ATGGAGCTCTCGGAGTCTGT GGTGCTTTCCTGCCTCTAGT COMMD3 COMM domain containing 3 NM_012071 218 609-826 AAGCCTGGAAAGAGCAACTC TGGGCAGTATCTTTCCCTCT CPM carboxypeptidase M (CPM), transcript variant 1 NM_001874 220 714-933 AAGCTTAACGCCTGATGATG TTTACAGCATGACAGCTCCA CPM carboxypeptidase M (CPM), transcript variant 1 NM_001874 187 451-637 AACCCAGATGGATTTGAAGC TTGCAGAGAGGACAAACGTC CPN1 carboxypeptidase N, polypeptide 1 NM_001308 239 271-509 TGCTCTCAGTCTTCCTCCAC CCCCACATACTTGACCTCTG CPN1 carboxypeptidase N, polypeptide 1 NM_001308 187 721-907 CAAATGGAGTGGACCTGAAC TGGAGATTGGCTGAAAGAAC CRABP1 cellular retinoic acid binding protein 1 NM_004378 166 211-376 AGGACGGGGATCAGTTCTAC AGAAGAGTTTGGGTGCAGTG CRABP1 cellular retinoic acid binding protein 1 NM_004378 162 252-413 CGCACCACTGAGATCAACTT CTCACGGGTCCAGTAGGTTT CRABP1 cellular retinoic acid binding protein 1 NM_004378 249 318-566 TGCAGGAGTTTAGCCACTTG CCACTGGCAGCTCAGAACTA CRABP2 cellular retinoic acid binding protein 2 NM_001878 290 146-435 CTTCTCTGGCAACTGGAAAA GCTTCTGCTCACAGACCATT CSF2 colony stimulating factor 2 NM_000758 234 152-385 GCGTCTCCTGAACCTGAGTA ATAATCTGGGTTGCACAGGA CSF2 colony stimulating factor 2 NM_000758 204 #3 GCTTGTCATCCCCTTTGACT CATGCCTGTATCAGGGTCAG CSF2 colony stimulating factor 2 NM_000758 CGTCTCCTGAACCTGAGTAGA TGCTGCTTGTAGTGGCTGG CSF2 colony stimulating factor 2 NM_000758 195 364-558 CTTCCTGTGCAACCCAGATT CTTGGTCCCTCCAAGATGAC CSF2 colony stimulating factor 2 NM_000758 317 127-443 ATGTGAATGCCATCCAGGAG GTCAAAGGGGATGACAAGCA CSF2 colony stimulating factor 2 NM_000758 248 180-427 GCTGCTGAGATGAATGAAAC AGCAGAAAGTCCTTCAGGTT CSN1S1 casein alpha s1 NM_001890 165 282-446 CAGAGCCTGAGAAGATGGAA GGACATGGCTGTTTTCATTC CSN1S1 casein alpha s1 NM_001890 181 303-483 CCAGCATCAGTTCATCGAGT TAGGCAGCAAGTTGGTTGAG CSN1S1 casein alpha s1 NM_001890 CSN1S1 casein alpha s1 NM_001890 CSN1S2A alpha-S2-like casein A AY154892 234 115-348 AGCACTCCTCCTCTTCCAGT ACTGGTTGGTTTTCGTCTCA CSN1S2A alpha-S2-like casein A AY154892 183 210-392 AGTGGGGAATCTGCTCAAGT GGGAACAGCCTGGACATACT CSN1S2A alpha-S2-like casein A AY154892 CSN1S2A alpha-S2-like casein A AY154892 CSN2 casein beta NM_001891 195 393-587 ACCCTCAAATCCCAAAACTC GCACAGCTCTCTGAGGGTAG CSN3 casein kappa NM_005212 190 13-202 ACCTACTGCCAACCAAGACC CATTGGGACATATGGAGCTG CSN3 casein kappa NM_005212 191 420-610 CCCCAAAGAAAATTCAGGAT TTTTTATGCCGTAGGTGGAG CSN3 casein kappa NM_005212 188 144-331 CATGCCATGAGAATGATGAA GGCATGTGGCCTAACTACAG CSNK1A1 Casein kinase 1, alpha 1 NM_001025105 214 CTATTCCGCATTCTTTTCAG ATCATCTGCTCTGCTTCTTC CSNK1E casein kinase 1, epsilon NM_152221 184 2207-2390 AATTCCCGTTCTCCTGTGTC ATGCCTTCTGGAAGCAGTCT CSNK1E casein kinase 1, epsilon NM_152221 165 1338-1502 TGGCAATACTTCTCCCAGAG AGATGGTCAAATGGCACACT CSNK1E casein kinase 1, epsilon NM_152221 206 2493-2698 GGTTTTGGATTAACCCATCC CCCCCAAAGTTCTTCAGTTT CSRP2 CSRP2 binding protein NM_020536 156 866-1021 AAATGGATACCAGCCAGTCA GTACATTGCCAACATGACGA CTGF connective tissue growth factor NM_001901 278 976-1253 TCCGTACTCCCAAAATCTCC TGCCATGTCTCCGTACATCT CTGF-3 connective tissue growth factor NM_001901 264 543-806 GGAGAGTCCTTCCAGAGCAG CAGGCAGTTGGCTCTAATCA CTGF-4 connective tissue growth factor NM_001901 215 772-986 GCCCAGACCCAACTATGATT GGGAGTACGGATGCACTTTT CTGF-4 connective tissue growth factor NM_001901 CTGF-5 connective tissue growth factor NM_001901 153 1375-1527 GGAAAAGATTCCCACCCAAT TGCTCCTAAAGCCACACCTT CTGF-5 connective tissue growth factor NM_001901 CTGF-6 connective tissue growth factor NM_001901 189 1622-1810 TTAGCGTGCTCACTGACCTG TTCACTTGCCACAAGCTGTC CTGF-6 connective tissue growth factor NM_001901 CTHRC1 collagen triple helix repeat containing 1 NM_138455 150 596-745 GTTCAGGACCTCTTCCCATT CAACCCAGATAGCAACATCC CTHRC1 collagen triple helix repeat containing 1 NM_138455 183 703-885 GAAGGAATTGGTGCTGGATT TGAACCATTCCAAGGCATAA CTHRC1 collagen triple helix repeat containing 1 NM_138455 165 527-691 GCTCACTTCGGCTAAAATGC CCACAGAAGAAGTGCGATGA CTNNB1-1 NM_001904 181 2199-2379 TGAGGACAAGCCACAAGATTAC TCCACCAGAGTGAAAAGAACG CTNNB1-2 NM_001904 240 1413-1652 CCTTGGGACTCTTGTTCAGC GCCATCTCTGCTTCTTGGTG CTNNB1-3 NM_001904 242 347-588 TGAGTGGTAAAGGCAATCCTG AGCCAAACGCTGGACATTAG CTSG-1 235 AGGTCAGAGCAGATGTGGAG TCGATTCCGTCTGACTCTTC CTSG-2 170 TGAGAGTGCAGAGGGATAGG CGACTTTCCATAGGAGACGA CUL7 cullin 7 NM_014780 111 842-952 GTGCAGGCCGGATGATACAA TGTCAAAATCCAGGTGTTTCTCA CXCL10 chemokine (C-X-C motif) ligand 10 NM_001565 206 241-446 tccacgtgttgagatcattg tgtagggaagtgatgggaga CXCL10 chemokine (C-X-C motif) ligand 10 NM_001565 193 41-233 tacagcagaggaacctccag ggcttgcaggaataatttca CXCL10 chemokine (C-X-C motif) ligand 10 NM_001565 293 427-719 tctcccatcacttccctaca ctgataaaccccaaagcaga CXCL12 chemokine (C-X-C motif) ligand 12 NM_199168 168 1333-1500 GTGATTGCCTCTGAAGCCTA AATGTCACCTTGCCAACAGT CXCL12 chemokine (C-X-C motif) ligand 12 NM_199168 236 NYO AACAGGGAGCTGGAAAAAGT AGTCGGGGAGAGAGTAGGAA CXCL12 chemokine (C-X-C motif) ligand 12 NM_199168 ATGCCCATGCCGATTCTTCG GCCGGGCTACAATCTGAAGG CXCL5-3 Chemokine (C-X-C motif) ligand 5 NM_002994 211 1822-2032 TAGTCCTGGTGGGACACACT AGGGAGGAGCTTTCCTACAA CXCL5-4 Chemokine (C-X-C motif) ligand 5 NM_002994 220 396-615 ATCCAGAAGCCCCTTTTCTA GAGGAATCCAGGAAGAAAGC CXCL5-5 Chemokine (C-X-C motif) ligand 5 NM_002994 198 1274-1471 AACAGGCAAATTCCTGACTG GTCCCCTATCCAAGGAGAAA CXCR4-2 Chemokine (C-X-C motif) receptor 4 NM_001008540 159 145-303 GGAAAAGATGGGGAGGAGAG CACTTCCAATTCAGCAAGCA CXCR4-3 Chemokine (C-X-C motif) receptor 4 NM_001008540 227 778-1004 GGTGGTCTATGTTGGCGTCT TGGAGTGTGACAGCTTGGAG CXCR4-4 Chemokine (C-X-C motif) receptor 4 NM_001008540 153 984-1136 TCTCCAAGCTGTCACACTCC ACCCTTGCTTGATGATTTCC CXCR7 chemokine (C-X-C motif) receptor 7 NM_020311 198 981-1178 CCTACGTGGTGGTCTTCCTT AGTTGCGATTGATGAAGCTG CXCR7 chemokine (C-X-C motif) receptor 7 NM_020311 179 445-623 TGACACGCACTGCTACATCT ACGTGAGGAAGAAAATGCTG CXCR7 chemokine (C-X-C motif) receptor 7 NM_020311 194 1320-1513 TCTGGGACGGGTTTACTTGT CTGCCTGTTGCAAAACTGTC CYGB cytoglobin NM_134268 150 1291-1440 GTGTTCTGGCAAAGAGGAAA ACTCCTTTCTGCCTGGAAGT CYP2A13-3 Cytochrome P450, family 2, subfamily A, polypeptide 13 NM_000766 177 1248-1424 CCAGCACTTCCTGGATAAGA TCGATATCCTTAGGCGACTG CYP2A13-4 Cytochrome P450, family 2, subfamily A, polypeptide 13 NM_000766 191 832-1022 ATGCAGGAGGAGGAGAAGAA TTCTTGCCGATCACTCTGTC CYP2A13-5 Cytochrome P450, family 2, subfamily A, polypeptide 13 NM_000766 220 125-344 CATTGCCCTTCATTGGAAAC TTGAAGAGCCAGTCGAAGGT CYP2A13-6 Cytochrome P450, family 2, subfamily A, polypeptide 13 NM_000766 245 1377-1621 CATGCAGAACTTTCGCTTCA CTAACCACCTCTCCCCTTCC CYP2A13-7 Cytochrome P450, family 2, subfamily A, polypeptide 13 NM_000766 240 1453-1692 ACGATCCCACGAAACTACAC CCTTCCTCTCATCACAGCTC CYP2A13-8 Cytochrome P450, family 2, subfamily A, polypeptide 13 NM_000766 221 505-725 GCCAATATCGATCCCACCTT TTAAAGGCCTGTTGCTGTGG CYP2A13-9 Cytochrome P450, family 2, subfamily A, polypeptide 13 NM_000766 201 884-1084 TGATGACCACCCTGAACCTC TCTCGTGGATCACTGCCTCT CYP2E1 cytochrome P450, family 2, subfamily E, polypeptide 1 NM_000773 199 1200-1398 AGTGCCAACTCTGGACTCTG CAAAATGGCACACAACAAAA CYP2E1 cytochrome P450, family 2, subfamily E, polypeptide 1 NM_000773 78 503-581 CACTCAGGAAGACCCAAGGCC ATGTCGGCTATGACGTTGCA CYP2E1 cytochrome P450, family 2, subfamily E, polypeptide 1 NM_000773 165 1045-1209 ATCCCTGCCATCAAGGATAG AGTTGGCACTACGACTGTGC CYP2E1 cytochrome P450, family 2, subfamily E, polypeptide 1 NM_000773 201 1150-1350 ACCCGAGACACCATTTTCAG TCCAGCACACACTCGTTTTC CYP3A5 cytochrome P450, family 3, subfamily A, polypeptide 5 NM_000777 191 502-692 AGCGGAAAACTCAAGGAGAT GGGTCTTGTGGATTGTTGAG CYP3A5-3 cytochrome P450, family 3, subfamily A, polypeptide 5 NM_000777 193 1114-1306 GCACCACCTACCTATGATGC ACTTTGGGTCATGGTGAAGA DAB2 Disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila) (DAB2) NM_001343 152 CCCTACTGAACCCTACCTCT GAACCCCCAAACAACTCT DACH1 dachshund homolog 1 NM_080759 178 2179-2356 GCTCAAGAGAAACAGGTCCA CAAGTGCTTCCTGCAATTTT DAD1 defender against cell death 1 NM_001344 191 64-254 GTTATGTCGGCGTCGGTAGT CAAGAGATGAAGCCCGAGAG DCDT testis expressed 11 NM_001921 213 240-452 GGCCTTCTTATCAGCACAGA TTGTTCATGATGGCATTCAG DCDT testis expressed 11 NM_001921 207 915-1121 TAAAATAGGGGAGCCTGTGG TCGTCCCCATTAAGAACACA DCDT testis expressed 11 NM_001921 205 454-658 AATTCGACCGATGTGAAAGG TCTTGCTGCACTTCGGTATG DCK deoxycytidine kinase NM_000788 180 629-808 ACTGGCATGACTGGATGAAT GGAGCCAGCTTTCATGTTTA DCK deoxycytidine kinase NM_000788 180 469-648 CGAATAAGAGCTCAGCTTGC ATTCATCCAGTCATGCCAGT DCK deoxycytidine kinase NM_000788 223 297-519 AGATTGGGAAGTGGTTCCTG CTCTGCATCTTTGAGCTTGC DCK deoxycytidine kinase NM_000788 226 749-974 AGCAAGGCATTCCTCTTGAA AACCATTTGGCTGCCTGTAG DCLRE1A DNA cross-link repair 1A NM_014881 176 1704-1879 ACGACATGGTCCCTTACTGA CACCAGTACATGCCAGATCA DCLRE1A DNA cross-link repair 1A NM_014881 248 3537-3784 GGCATTTCGACCTACAGGAT ATCCAGCTTCCAATTTCCAC DCLRE1B DNA cross-link repair 1B NM_022836 172 1354-1525 CGGATCAAGAAGCAGTTGTT CAATTTCCTCCCTGGTTTTT DCLRE1C DNA cross-link repair 1C NM_022487 159 2505-2663 AGTCTGGGTGACAGAGCAAG TGGAGTGCAATGACACAATC DCLRE1C DNA cross-link repair 1C NM_022487 185 1789-1973 CTGCCTCTCTCATGGAACAA AGAGCTCTGGGAATCTGCAT DCN decorin NM_001920 178 784-961 ACACCTTTGGTGAAGTTGGA GATTGGTGCCCAGTTCTATG DDAH1 dimethylarginine dimethylaminohydrolase 1 NM_012137 232 2937-3168 CCAGTTTAGGCTTACCAGCA TGCAATGTAGAAGAGGCACA DDAH1 dimethylarginine dimethylaminohydrolase 1 NM_012137 242 476-717 TGGCGGAGATGTTTTATTCA GGTGGTCACTCATCTGTTGC DDB2-1 NM_000107 206 1350-1536 CTGGCATCAGTTCGCTTAAT TTTGGCCCTTTAACAAATCA DDB2-2 NM_000107 187 616-802 CACCTTCATCAAAGGGATTG CACATCCAGGCTACAAAACC DDHA2 dimethylarginine dimethylaminohydrolase 2 NM_013974 236 206-441 GCTGGAGACAGGTGAAGAAA TCGTTGCCTCAGTTTACCTC DDHA2 dimethylarginine dimethylaminohydrolase 2 NM_013974 192 1056-1247 GTCCTGCTCAGAACTGGAGA ATTGAGGCTCTCTCCCAACT DDHA2 dimethylarginine dimethylaminohydrolase 2 NM_013974 230 414-643 GGTGCTGGGAGGTAAACTGA TCGCGTTCTCGTCTCCTATT DDIT3 DNA-damage-inducible transcript 3 NM_004083 193 413-605 AGAGCCCTCACTCTCCAGAT TTGAGCCGTTCATTCTCTTC DDIT3 DNA-damage-inducible transcript 3 NM_004083 169 586-754 GAAGAGAATGAACGGCTCAA CAGTAGCCACTTCTGGGAAA DDIT3 DNA-damage-inducible transcript 3 NM_004083 210 179-388 AGATGGCAGCTGAGTCATTG GTTCTGGCTCCTCCTCAGTC DEFB1 defensin, beta 1 NM_005218 196 146-351 TCGCCATGAGAACTTCCTAC GCCTTCCCTCTGTAACAGGT DEFB4 defensin, beta 4 NM_004942 153 74-226 TATTCCTGATGCCTCTTCCA GCTTTTTGCAGCATTTTGTT DENND2A DENN/MADD domain containing 2A NM_015689 158 2748-2905 TTCTGGAACAGAGGAACGAG CGACGTCAGGAACAAAGAGT DEPDC1 DEP domain containing 1 NM_001114120 291 1763-2053 tggaaagtgaactcggagag tcagtgacctcgtacccatt DES desmin NM_001927 152 1347-1498 CAGACCTACTCTGCCCTCAA TAGAGCACTTCATGCTGCTG DFNB31 deafness, autosomal recessive 31 NM_015404 216 3620-3835 TTGCAAGACAGGAAGAAAGG AGGTGCTCGATGCTTATTTG DFNB31 deafness, autosomal recessive 31 NM_015404 222 958-1179 GCTGCTCTTCGACCAATACA GCTAGAGAGCCTGGTTCCAC DFNB31 deafness, autosomal recessive 31 NM_015404 157 1329-1485 GCTACGTCACCAACCACATC TTTTTCTCATCCCCTCCTTG DFNB31 deafness, autosomal recessive 31 NM_015404 230 1544-1773 GAGTACGGCCTTGGCATTTA ATCCACTTGGTCTCGTCCAC DFNB31 deafness, autosomal recessive 31 NM_015404 233 1822-2054 TGGCGATCTCACAACAGAAG TGTTGAGCAGCTTGAACAGG DFNB31 deafness, autosomal recessive 31 NM_015404 221 3435-3655 TTGGCTTCATCAAGCTCCTT CTCTGCCCTTCCTTTTCCTT DGAT1 diacylglycerol O-acyltransferase homolog 1 NM_012079 168 529-696 CATCCTGAACTGGTGTGTGG AAGACATTGGCCGCAATAAC DGAT1 diacylglycerol O-acyltransferase homolog 1 NM_012079 187 1755-1941 CTTCTCACTGCCACCTCACA CAGCTGGCATCAGACTGTGT DGAT1 diacylglycerol O-acyltransferase homolog 1 NM_012079 301 995-1195 TACCCGGACAATCTGACCTA CTTCATGGAGTTCTGGATGG DGAT2 diacylglycerol O-acyltransferase homolog 2 NM_032564 182 406-587 TCAATAGGTCCAAGGTGGAA TTTCTTGGGTGTGTTCCAGT DGAT2 diacylglycerol O-acyltransferase homolog 2 NM_032564 232 1429-1660 CCAGCTGCAAATCACTTTTT CAGGAAGGGAAGAAGAGAGG DGAT2 diacylglycerol O-acyltransferase homolog 2 NM_032564 172 1185-1356 CTCTTCTCCTCCGACACCTG TGGTCTTGTGCTTGTCGAAG DHCR24 24-dehydrocholesterol reductase NM_014762 217 1844-2060 CCAGTGGAATGGAAAGAATG GAGCTACCACTTACCCAGCA DHCR24 24-dehydrocholesterol reductase NM_014762 216 3079-3294 GCTGCAGTTTCCTCATCTGT TGAGCCTTTCTGGAAATGAG DHCR24 24-dehydrocholesterol reductase NM_014762 189 3826-4014 CCTGGAAAGAGGCAGTCTTC TTCATGCAGCCAAGAAACTC DHCR7 7-dehydrocholesterol reductase NM_001360 172 2420-2591 TTTTCTGCTTGCCCTATGAC ACACCCTAGGGATGAGGAAG DHCR7 7-dehydrocholesterol reductase NM_001360 166 1403-1568 TCATCGAGTGCTCCTACACA TAGAAGTAGGGCAGCAGGTG DHCR7 7-dehydrocholesterol reductase NM_001360 156 1201-1356 GACTGTGTCTGGCTGCCTTA GAACAGGTCCTTCTGGTGGT DIAPH1 diaphanous homolog 1 NM_005219 156 3761-3916 TGTGCAGTCACATCTCTGCT GTCACAGGACCCACATTAGC DIAPH1 diaphanous homolog 1 NM_005219 167 3146-3312 TTCTTGGCTGAGTTGTGTGA GGGAAATTCTGAACATCACG DIAPH1 diaphanous homolog 1 NM_005219 187 5298-5484 TCCCCAGCTAGGAAGAAAGA CCTCCCAGGAATAGTCCAAA DIAPH1 diaphanous homolog 1 NM_005219 217 610-826 TGTCAGTTGGGTGCAAACAT CATGGCTCTGACCAGCAGTA DIAPH2 diaphanous homolog 2 NM_006729 244 592-835 AGTCGCGATGAGTGAGTTTC AGACAGGGTGCATTCATGTT DIAPH3 diaphanous homolog 3  NM_001042517 108 2580-2687 ggttgtgatgagcaatgtga acagccatgatgtcaggttt DKK2 dickkopf homolog 2 NM_014421 166 2628-2793 GGGGATGCACAGTCTAAATG CCATTTTGTGAAACCTCCTG DKK3 dickkopf homolog 3 NM_015881 189 2329-2517 GGTAATTGTAGGGCGAGGAT CAACAGTCCATGACACCTGA DKK3 dickkopf homolog 3 NM_015881 146 1659-1804 GGGGAAATGTGGAGAAGAGT ATGCAGGGTGAACAGAACAT DKK3 dickkopf homolog 3 NM_015881 174 990-1163 CTCATCACCTGGGAGCTAGA ATACTCATCGGGGACCTCTC DLG7 discs, large (Drosophila) homolog-associated protein 5 NM_014750 105 1728-1832 cagatctggatggattttgg tattgacttgccacccagat DLX3 distal-less homeobox 3 NM_005220 222 1883-2104 GGCATTGTTCACAGATAGGG TACACCTCACCCGACATTCT DNAI2 dynein, axonemal, intermediate chain 2 NM_023036 195 1638-1832 GCTGAAGGAGAAGGGTAAGG TGGTCTTCTTCTGGACTTGG DNAI2 dynein, axonemal, intermediate chain 2 NM_023036 191 441-631 CTGCATCAAGCAGAACAATG AGTATGCCACTGCCAACTTC DNAI2 dynein, axonemal, intermediate chain 2 NM_023036 183 714-896 ACTTGCTCTGAAGCCATCGT CAGATGGTGCCATACACAGG DNAI2 dynein, axonemal, intermediate chain 2 NM_023036 187 2016-2202 GAAGGGTTTCTCCTCCATGA ATTCAGGTGCAGCAGAACAG DNAI2 dynein, axonemal, intermediate chain 2 NM_023036 228 1183-1410 ATCTACGCCCTCCAGAGAAA GCACTGCTCGAACATGAAGT DNAI2 dynein, axonemal, intermediate chain 2 NM_023036 163 877-1039 CCTGTGTATGGCACCATCTG CCAAGGCATTTTCCAACTGT DNAI2 dynein, axonemal, intermediate chain 2 NM_023036 231 503-733 TGGAAGTGATGGAGGAGGAC ACGATGGCTTCAGAGCAAGT DNAI2 dynein, axonemal, intermediate chain 2 NM_023036 156 276-431 AGAGCGGTTTGAGATGGAGA ATAGAGCCGAGCTGCATGAT DNAI2 dynein, axonemal, intermediate chain 2 NM_023036 199 1020-1218 ACAGTTGGAAAATGCCTTGG CTTCGGGTAGAAGGGGTTTC DNAJB9 DnaJ (Hsp40) homolog, subfamily B, member 9 NM_012328 177 635-811 CAGGATGGTGGTTCCAGTAG GCAGTGCTTGCTAGATCCAT DNMT1 DNA (cytosine-5-)-methyltransferase 1 NM_001379 160 CTGGGGAGACCACCAACT CTGAGGAAGGAAACCACCA DNMT3A DNA (cytosine-5-)-methyltransferase 3 alpha NM_175629 287 CTGTGATGATTGATGCCAAA GACTGGGAAACCAAATACCC DNMT3B DNA (cytosine-5-)-methyltransferase 3 beta NM_006892 265 ATAAGACACCCCCTCAAACC TTCCCGTTCTCCCTAAAAAC DOK4 docking protein 4 NM_018110 190 1868-2057 TGGAGTGACACAGGAAGGAT AGGTAATCAGCACCCCTACC DPPA5 developmental pluripotency associated 5 NM_001025290 180 342-521 CCTTGGATGAAGTGAACCAG AGACTCAGAGCCAAGGGTTT DRAM damage-regulated autophagy modulator NM_018370 232 1057-1288 CGTAGTGAGTGCGATCTGTG GCAGATGCATCCCAATAATC DRG1 developmentally regulated GTP binding protein 1 NM_004147 162 474-635 CTCCTGGATCTCCCAGGTAT AAAGCCTTCCAGCTCATTTT DTL denticleless homolog NM_016448 286 710-995 gattggaacatgcaaaggtc ctcgtcttgaaagaggacca DUSP11 dual specificity phosphatase 11 NM_003584 221 658-878 ACTGGCTACCTCATTTGCAG GGCTTATTGTGGACTGGTTG DUSP1-2 dual specificity phosphatase 1 NM_004417 230 1401-1630 CCTTGAGAGGAGAAATGCAA AAAAGAAACCGGATCACACA DUSP1-3 dual specificity phosphatase 1 NM_004417 182 614-795 AGGAGGATACGAAGCGTTTT GGTACAGAAAGGGCAGGATT DUSP1-4 dual specificity phosphatase 1 NM_004417 154 942-1095 GACATCAGCTCCTGGTTCAA CGTCCAGCTTGACTCGATTA DUSP19 dual specificity phosphatase 19 NM_080876 261 543-803 CCTGAAACCAACATCCTGTC ATTGCTTTCTTTGCCCTCTT DUSP19 dual specificity phosphatase 19 NM_080876 283 4255-4537 TTTCAGTGGTAGTGGGGAAA CCTTCAGGCAGAAAAATCAA DUSP19 dual specificity phosphatase 19 NM_080876 240 2500-2739 TGGCCTGATAGTTTCCACAT TCTTGTCACGGTGTAAGCAA DUT deoxyuridine triphosphatase NM_001025248 157 1914-2070 CTATCAGCCCACTTGACCAC TGGCTATGTCCCACTGAGTT DYNLT1 dynein, light chain, Tctex-type 1 NM_006519 177 233-409 ACACAGCAAGTTCCTGCTTC ATTCATGGCTGGTGGTTAGA DYNLT1 dynein, light chain, Tctex-type 1 NM_006519 150 150-299 TTTAAGCCAACTCACCAAGC TTATTCTCCCATCGCACAGT DYNLT1 dynein, light chain, Tctex-type 1 NM_006519 242 114-355 AGTGAACCAGTGGACCACAA GCTGGACTGCAGGTCAAATA DYNLT1 dynein, light chain, Tctex-type 1 NM_006519 228 285-512 GCGATGGGAGAATAAGACCA ATCTGACTTCGGTGCCATTC E2F1 E2F transcription factor 1 NM_005225 288 872-1159 ACCTTCGTAGCATTGCAGAC GATCTGTGGTGAGGGATGAG E2F1 E2F transcription factor 1 NM_005225 308 1773-2080 GTCCACATGTGTGTGCATGA AGGGAGTTGGGGTATCAACC E2F1 E2F transcription factor 1 NM_005225 97 889-1176 ACCTTCGTAGCATTGCAGAC GATCTGTGGTGAGGGATGAG E2F1 E2F transcription factor 1 NM_005225 192 1416-1607 GACTGTGACTTTGGGGACCT CCAGACCCCAGAGCTAGAAG E2F1 E2F transcription factor 1 NM_005225 242 1954-2195 AGGACGGTGAGAGCACTTCT CCTCCCTCACTTTCCCAATA E2F5 E2F transcription factor 5, p130-binding NM_001951 108 610-717 GGCACCTTCTGGTACACAAC AGCACATGGATAGGTCCTGA E2F5 E2F transcription factor 5, p130-binding NM_001951 122 274-395 TGCTGATACTTTGGCTGTGA CAGCACCTACACCTTTCCAC E2F5 E2F transcription factor 5, p130-binding NM_001951 113 493-605 GTGGCTACAGCAAAGCATCA TGGCCAAAAGTGTATCACCA ECT2 epithelial cell transforming sequence 2 oncogene NM_018098 137 1258-1394 AAGCTCCACTCCAGTTCCTT GTCCTTCCTCTTCCAATGGT ECT2 epithelial cell transforming sequence 2 oncogene NM_018098 140 930-1069 TCAAGCAAGAGTGGTTCTGG GCGATTGCTGTTAGGGGTAT ECT2 epithelial cell transforming sequence 2 oncogene NM_018098 172 2611-2782 TGTCAGCCTTCCTTCCTTCT CCAGCTTTCACCAAGTGCTA EDA variant2 ectodysplasin A (EDA), transcript variant 2 NM_001005609 213 1158-1371 CAGGTATACTACATCAACTTCACTGAC GTGGTGTGCTTGCTCATGTT EDA variant2 ectodysplasin A (EDA), transcript variant 2 NM_001005609 220 1158-1378 CAGGTATACTACATCAACTTCACTGAC CAAAGAACGTGGTGTGCTTG EDA variant2 ectodysplasin A (EDA), transcript variant 2 NM_001005609 407 1158-1565 CAGGTATACTACATCAACTTCACTGAC CCTGGAGTCACTGGGGAATA EDA2R-1 NM_021783 165 846-1010 GTCGAAAGCACTGGAGACAG TGTGGACATCACATTTCAGG EDA2R-2 NM_021783 160 495-654 TGCAAGCAGTTCTTCAACAG TAAGTGGCTGGGTCTGAAAG EDAR-1 ectodysplasin A receptor NM_022336.1 127 818-944 ACATCTATGGCATGGTCTGC AAGGGAGACAGGGTGCTG EDAR-2 ectodysplasin A receptor NM_022336.1 101 792-893 CTACATGCTGGAGAACAGACC CTGAAGTGGCTCCCACAC EDAR-3 ectodysplasin A receptor NM_022336.1 224 3648-3872 CCTGCCTTGTGATGATGATG AGAGCCAATGGAACATGAGC EDAR-4 ectodysplasin A receptor NM_022336.1 251 3070-3320 GGCCTTTGAGGTGCTCTATG CATCAGGGAGTTCAGCAGTG EDN1 Endothelin 1 NM_001955 196 572-767 CCAAGCAGGAAAAGAACTCA TGATTTGACGCTGTTTCTCA EDN1 Endothelin 1 NM_001955 151 441-591 GTTGTTCCGTATGGACTTGG TGAGTTCTTTTCCTGCTTGG EDN1 Endothelin 1 NM_001955 242 938-1179 TCCTCTGCTGGTTCCTGACT CAGAAACTCCACCCCTGTGT EDNRB endothelin receptor type B NM_000115 166 761-926 AGCTGGTGCCTTTCATACAG ACAGAGACCACCCAAATCAA EGFR EGR1 early growth response 1 NM_001964 194 2132-2325 CCATGTCCAAGTTCTTCACC AAATCCATGGCACAGACACT EGR1 early growth response 1 NM_001964 249 369-617 TAAGCTGGAGGAGATGATGC AGCACCTTCTCGTTGTTCAG EGR1 early growth response 1 NM_001964 203 569-771 TGACCGCAGAGTCTTTTCCT TGGGTTGGTCATGCTCACTA EIF2B4 eukaryotic translation initiation factor 2B, subunit 4 delta NM_172195 179 818-996 ACACAACACCGCCTAATGAA TTCTGACTTGGCCTCCTCTT EIF2B4 eukaryotic translation initiation factor 2B, subunit 4 delta NM_172195 202 1472-1673 ATGACCCTGATGATCTGCAA CGTCACTGGTCACTGCTCTT EIF2B4 eukaryotic translation initiation factor 2B, subunit 4 delta NM_172195 228 109-336 CTTTGTGCCCTGTTTTCTGA TTCTGGCAGTTCTCTGGTTG EIF4E eukaryotic translation initiation factor 4E NM_001968 217 1541-1757 GGAAACCACCCCTACTCCTA ATGGTTGTACAGAGCCCAAA EIF4E eukaryotic translation initiation factor 4E NM_001968 213 426-638 TCTTTAGGAAGGCACGCAGT TTTAGGCCGGGTCAACTATG EIF4E eukaryotic translation initiation factor 4E NM_001968 157 914-1070 ACGAATGACCACCAGCATTA GTTGAGGTCCCAGGACAAGT EIF4EBP2 eukaryotic translation initiation factor 4E binding PROTEIN 2 NM_004096 239 1562-1800 AAGAACGTTGACCCATTTGA CAACAGGAAAGGCAAGAAAA EIF4G1 eukaryotic translation initiation factor 4 gamma, 1 NM_182917 181 3234-3414 TGGACTTTGAAAAAGCCAAG TGGATCTGGTCAATGGTCTT EIF4G1 eukaryotic translation initiation factor 4 gamma, 1 NM_182917 224 4938-5161 ACCTGTGTGACGAGCAGAAG CCACTTGAAGAAGGCTGTGA EIF4G1 eukaryotic translation initiation factor 4 gamma, 1 NM_182917 182 641-822 CCTGCTGGATCCCAAGTAAT GCGTAGGTCCCAAATTCTGT EIF4G3 eukaryotic translation initiation factor 4 gamma, 3 NM_003760 163 4631-4793 AAGAGCTGGGGTCTTGCTAT GAAGTCCAACTTCTGCTCCA EIF4G3 eukaryotic translation initiation factor 4 gamma, 3 NM_003760 201 2174-2374 TGAAGAGGAGCTTTCCATTG TCTGTGGAGCCTGAATTAGC EIF4G3 eukaryotic translation initiation factor 4 gamma, 3 NM_003760 203 1219-1421 CTAGCGACCAGAAGCAAGAG TGCAATTGTACTTCGAGCAA ELA2 Elastase 2 NM_001972 158 CGTGGCGAATGTAAACGTC TGAGCTGGAGAATCACGATG ELA2-12 248 TACGACCCCGTAAACTTGCT CTCACGAGAGTGCAGACGTT ELA2-13 187 CTCTACCCCGATGCCTTTG TATTGTGCCAGATGCTGGAG EME1 essential meiotic endonuclease 1 homolog 1 NM_152463 242 1633-1874 TAAAGAACGCCAGAATTTGC GTGCTGCCAGTCTCTTCATT ENDOD1 endonuclease domain containing 1 NM_015036 199 3687-3885 TACTGCATCCCATGGAAACT TGGCCACCCAAGAATAAATA ENDOD1 endonuclease domain containing 1 NM_015036 203 1060-1262 GGAAAACTCATGGGCTTCAT CTCACCAACTCTTCCCCAAT ENPP2 ectonucleotide pyrophosphatase/phosphodiesterase 2 NM_001040092 197 2191-2387 TGGTTCCAATGTATCCTGCT GTGAGTTGGAACAGGAATGG ENPP2 ectonucleotide pyrophosphatase/phosphodiesterase 2 NM_001040092 197 1449-1645 GCAAGGAAACCTTTGGATGT TTCAATCCCAGGAGATCACA ENPP2 ectonucleotide pyrophosphatase/phosphodiesterase 2 NM_001040092 244 866-1109 ATGGATTACAGCCACCAAGC ATCCATTAATTGCCCCACAA ENPP2 ectonucleotide pyrophosphatase/phosphodiesterase 2 NM_001040092 230 33-262 ACTCCGTGAAGGCAAAGAGA CAAGATCCGGAGATGTTGGT EOMES eomesodermin homolog NM_005442 180 1076-1255 GTTCCCACTGGATGAGACAG TCTTTGAGGGCTCATTCAAG EPAS1 endothelial PAS domain protein 1 NM_001430 225 4703-4927 ACACACACAAAGCACATTGG GCAACACACACAGGAAATCA EPAS1 endothelial PAS domain protein 1 NM_001430 184 2025-2208 GACCAATGCAGTACCCAGAC GTGGCTGGAAGATGTTTGTC EPHA1 EPH receptor A1 NM_005232 156 2870-3025 AACGCTACATCCTGCACTTC GGAGGGATCAGTCCTTGAAT EPHA2 EPH receptor A2 NM_004431 167 2961-3127 GACGACATCAAGAGGATTGG GAGGCCACTCTGTTTCTTCA EPHA4 EPH receptor A4 NM_004438 242 3831-4072 TTCTGCTATCTTGGCCTCAC GCAACTGGAGAACAGATGCT EPHB4 EPH receptor B4 NM_004444 216 3992-4207 TTAATTTTTCTCCCCGTTCC CACCCCTTCATAGGACACAG EPO1 Erythropoietin NM_000799 176 GCCCTGTTGGTCAACTCTT GTGTCAGCAGTGATTGTTCG EPOR1 Erythropoietin receptor NM_000121 203 CATGGATGAAGGCTCAGAAG TGCCAGAGTCAGATACCACA Eps15L1 epidermal growth factor receptor pathway substrate 15-like 1 NM_018370 174 1282-1455 AATGACCTAGACCGGGAAAC TTGCGTTTTCAGTGATGAGA Eps15L1 epidermal growth factor receptor pathway substrate 15-like 1 NM_018370 244 3088-3331 GGGATCCCCCTTGTAACACT CGTACTCTGCCCTCAAGGAG Eps15L1 epidermal growth factor receptor pathway substrate 15-like 1 NM_018370 150 944-1093 ATGGTCATCTCTGCCGTTTC AAAGGCCACTGTCCATTCAC ERBB2-3 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2 NM_004448 194 1645-1838 CCATAACACCCACCTCTGCT ACTGGCTGCAGTTGACACAC ERBB2-4 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2 NM_004448 187 3072-3258 CCATCTGCACCATTGATGTC GAGCGGTAGAAGGTGCTGTC ERBB2-5 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2 NM_004448 249 2425-2673 CGCTTTTGGCACAGTCTACA TCCCGGACATGGTCTAAGAG ERBB2-6 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2 NM_004448 215 4376-4590 AAGCGACCCATTCAGAGACT AAGTGGGTGTGGAGAAGGAC ERCC5 excision repair cross-complementing rodent repair deficiency, complementation group 5 NM_000123 199 2650-2848 TGGAAACTCTGGAGAGCAAC TGATCAGTCAGGTCCAGGAT ERCC5 excision repair cross-complementing rodent repair deficiency, complementation group 5 NM_000123 209 3405-3613 CAGACACAGCTCCGAATTGA TTCTGGGTTTTTCGTTTTGC ERCC6 excision repair cross-complementing rodent repair deficiency, complementation group 6 NM_000124 201 1102-1302 GAAAGCCAGAGTTCTGTCCA TCCTCTTCCTCCTCCTCTGT ERCC8 excision repair cross-complementing rodent repair deficiency, complementation group 8 NM_000082 176 974-1149 GGCTGCAGTTCAGAATTTGT GCCAGAATGTTGCAGTCTCT EREG Epiregulin NM_001432 185 GTGGCTTTGACCGTGATTCT ATCCCTGCCCATAAGTTTGA ERRFI1 ERBB receptor feedback inhibitor 1 NM_018948 186 431-616 AGGAGCGCCTAATACCACTT CCCCATTCACTGTGAGTTTC ERRFI1 ERBB receptor feedback inhibitor 1 NM_018948 131 1442-1572 CTGAACGACCACCATACCTG TGAGTCTGGCTTTTCTGTGG ERRFI1 ERBB receptor feedback inhibitor 1 NM_018948 284 683-966 TTTGTGAACGGGGTTCTAGG TGGAGGAGGATTTGGATCTG ESR1-1 NM_000125 211 GAGGATTCCCGTAGCTCTTC CCCTTGACCTAGCTTTCTCC ESR1-2 NM_000125 170 AGAGGGAAAGTAGGGCAGAA TGGGAAATGAAGAAGAGCTG ESR1-Ex5sp estrogen receptor 1 NM_000125 170 1338-1507 TGGATTTGACCCTCCATGAT GATCTCCACCATGCCCTCTA ESR1-Ex5sp estrogen receptor 1 NM_000125 180 1390-1511 GATCCTGATGATTGGTCTCG AACTCCTCTCCCTGCAGATT ESR2-1 NM_001437 266 TGTCCGCATTTTAGAGAAGG GGATATTCATGGTGGCTGTC ESR2-2 NM_001437 254 CCGACAAGGAGTTGGTACAC CCTTGAAGTAGTTGCCAGGA ESR2-3 NM_001437 151 GGCAGAGGACAGTAAAAGCA GGACCACACAGCAGAAAGAT ESR2-4 NM_001437 259 GGGCACCTTTCTCCTTTAGT TACATCCTTCACACGACCAG ESR2-Ex5sp estrogen receptor 2 NM_001437 244 1127-1371 CGGAGAGAGAGATGTGGGTA ACTTGGTCAGGGACATCATC ESR2-Ex5sp estrogen receptor 2 NM_001437 234 1348-1582 CATGATGATGTCCCTGACCA TCTACGCATTTCCCCTCATC F10 coagulation factor X NM_000504 208 211-418 CACCTCGAAAGAGAGTGCAT AGTTTTTGCCTTCGAATCCT F10 coagulation factor X NM_000504 190 319-508 GACCAGTGTGAGACCAGTCC AGGAGCACACCACAGAGTTC FABP2 fatty acid binding protein 2 NM_000134 226 597-822 CATGCCAAAGCAAAAGAAGT TTCCAGCCTGAGTGAAAGAG FABP2 fatty acid binding protein 2 NM_000134 245 1538-1782 CTGATGCAGCCTGTCCACTA ATTGTACCCCCTCTCCATCC FABP2 fatty acid binding protein 2 NM_000134 278 596-873 TCATGCCAAAGCAAAAGAAG GCATGAGTCCAGGAGTTTGA FABP4 fatty acid binding protein 4, adipocyte NM_001442 165 292-456 TCACTGCAGATGACAGGAAA AAACTCTCGTGGAAGTGACG FANCA Fanconi anemia, complementation group A NM_000135 232 2579-2810 GCAAGTTTTCTTCCCAGTCA TCCTCTTTCAACACCTCTCG FANCA Fanconi anemia, complementation group A NM_000135 207 3354-3560 ATGCGAGCAGTTCTTCCACT CACACCAGAGCAGAGGTCAA FANCB Fanconi anemia, complementation group B NM_001018113 199 960-1158 CTGCTTACAGCAGTGTGGTG AGGTTTCCTCCACCTGAATC FANCC Fanconi anemia, complementation group C NM_000136 218 1236-1453 CTCTGGAGAAAGCAAGCAAG GAACAGGAACCAGCTCTCAA FANCC Fanconi anemia, complementation group C NM_000136 242 1019-1260 GCAATGCTGCATCTTTTTGA AGCTGCTTGCTTGCTTTCTC FANCD2 Fanconi anemia, complementation group D2 NM_033084 186 2985-3170 GGAAGATCTCTCCCAGAAGC TGAATGTTCTCCAGGTGGTT FANCE Fanconi anemia, complementation group E NM_021922 179 834-1012 CCCAAAAGATTACGGTGTTG TCAGCCAGACCTTTAGCATC FANCE Fanconi anemia, complementation group E NM_021922 245 1650-1894 TATGCCAAGCTCATGCTGAC TATCCTCAGGCTAGGGCTCA FANCF Fanconi anemia, complementation group F NM_022725 177 1855-2031 ATGGAGTCTCGCTCTGTCAC GGTGAAACCCCGTCTCTACT FANCF Fanconi anemia, complementation group F NM_022725 190 739-928 GCTAGTCCACTGGCTTCTGG GGACTCAGTTCCAACCCAAA FANCI Fanconi anemia, complementation group I NM_001113378 153 1646-1798 ttgtccttcggaaagctatg ccacatgaacctgactgaca FANCL Fanconi anemia, complementation group L NM_001114636 176 1222-1397 AACATTTCGGTGAAGAGCTG GGCCTACAATTTCCCAGTTT FANCL Fanconi anemia, complementation group L NM_001114636 201 676-876 GGCATTCTGGGATGTTATGG ATTCCCAGGGGTTTTACCAC FBLN2 fibulin 2 NM_001004019 221 2219-2439 CTCAGCCATATGCTCCTGTT TCACACACTCGTTGATGTCC FBLN2 fibulin 2 NM_001004019 222 2125-2346 AGGTGGCCTCTAACACCATC CCAGGGTGTTCACACAGAAC FBLN2 fibulin 2 NM_001004019 FBLN2 fibulin 2 NM_001004019 FBOX10 F-box protein 10 NM_012166 213 2920-3132 AGGACACAGACCTGCTTCAG CCAGCTTCTATCCCTTCTCC FBOX10 F-box protein 10 NM_012166 212 783-994 ACTGTGAATTTGTGGGCAGT GCCCTCGATAACAATGTCAC FBOX10 F-box protein 10 NM_012166 249 3851-4099 TCAAGGTTTAGCCGAGACAC CTCCTCACTCAGGCCACTAA FETUB fetuin B NM_014375 241 1128-1368 TTCCTCTTCCTGGAGCCTAT CAAAAAGGCGTCCTTCACTA FETUB fetuin B NM_014375 175 213-387 GACTCAGATGTGCTGGCAGT GCACATGGCAGTCAGTCTCT FETUB fetuin B NM_014375 222 6-227 AACAAAACCGCTCAAGTCTG CAGCACATCTGAGTCATTGC FETUB fetuin B NM_014375 114 1076-1189 TGTGCATCTGGACCTAACCA GCTTTTTCTTTGGGGAAAGG FETUB fetuin B NM_014375 143 390-532 AGAAAGAAGGCATGGCAAGA TTTGAAACTGGGCGAAGAGT FGFR1 Fibroblast growth factor receptor 1 NM_015850 188 5001-5188 ATGTGTCTGCCCCCTCTATG AAGCCAAGATCTGCGACAGT FGFR1 Fibroblast growth factor receptor 1 NM_015850 215 1458-1672 GAAGTTCAAATGCCCTTCCA CCAGCTGGTATGTGTGGTTG FGFR1 Fibroblast growth factor receptor 1 NM_015850 201 4527-4727 ACCCCATCCATGCAGTAGAG TCCCAAAGTGCTGGGATTAC FGFR1-3? Fibroblast growth factor receptor 1 NM_015850 196 1975-2170 ATCGGACTCTCCCATCACTC TCTGGCTGTGGAAGTCACTC FGFR2 FGFR2-IIIb NM_022969 294 CCAAATACCAAATCTCTCAACC CGGTGTCATCCTCATCATCT FGFR2-2 Fibroblast growth factor receptor 2 NM_000141 249 3059-3307 TTACGAACCATGCCTTCCTC TTCTCCTCCTGGGGAAGATT FGFR2-3 Fibroblast growth factor receptor 2 NM_000141 242 1670-1911 GTGCTTGGCGGGTAATTCTA TACGTTTGGTCAGCTTGTGC FGFR2-4 Fibroblast growth factor receptor 2 NM_000141 224 379-602 AGGACCACTCTTCTGCGTTT CGTTAATCCCATCTGCACAC FGFR2-5 Fibroblast growth factor receptor 2 NM_000141 223 1103-1325 AGCACCATACTGGACCAACA CTTGTCAGATGGGACCACAC FGFR3 Fibroblast growth factor receptor 3 NM_000142 208 3504-3711 TTGGAGGTGATTCCAGTGAA ATAACATCGGAACCTGCACA FGFR3 Fibroblast growth factor receptor 3 NM_000142 231 253-483 ACTGTCTGGGTCAAGGATGG TGTGTCCACACCTGTGTCCT FGFR3 Fibroblast growth factor receptor 3 NM_000142 233 2911-3143 CTTGTGCCTGGGGTGTTAGT TCCGTTGTACCAGCCTTTTC FGFR3 Fibroblast growth factor receptor 3 NM_000142 151 730-880 GAGAACAAGTTTGGCAGCAT CGTCACTGTACACCTTGCAG FGFR4 Fibroblast growth factor receptor 4 NM_002011 161 2023-2183 TGGTGACTGAGGACAATGTG CACGTCACTCTGGTGTGTGT FGFR4 Fibroblast growth factor receptor 4 NM_002011 167 144-310 GTCCCTGAGAGCTGTGAGAA GCTACTGTCAGCTCCTGCTC FGFR4 Fibroblast growth factor receptor 4 NM_002011 231 1974-2204 CTGGAGTCCCGGAAGTGTAT TAGCAGGATCCCAAAAGACC FGFR4 Fibroblast growth factor receptor 4 NM_002011 166 2495-2660 CTCCAGCGATTCTGTCTTCA AAGGTCGAGCACTGTGTCAG FKBP15 FK506 binding protein 15, 133kDa NM_015258 189 2671-2859 AATCACAGCTCTCACCAAGC AGAATGGTCCTGCCATTGTA FKBP15 FK506 binding protein 15, 133kDa NM_015258 217 3860-4076 AACCACAGGGTGAGGTCAAG AAGTCTGGCAGAGGACAGGA FKBP15 FK506 binding protein 15, 133kDa NM_015258 151 284-434 ACAGGAAATCAGGCAACACC CTGTGTGGTTCCCCAGAACT FKBP2 FK506 binding protein 2, 13kDa NM_004470 246 187-432 GAGGAGAGACATGAGGCTGA GAGAAGACAAAGGGCTGGTT FKBP5 FK506 binding protein 5 NM_004117 235 3105-3339 GACCCCCTTCAAACCTAAAA GCTTTCCCAACAGTTTAGCA FKBP5 FK506 binding protein 5 NM_004117 184 519-702 AAAATTCCCTCGAATGCAAC CAAACATCCTTCCACCACAG FKBP5 FK506 binding protein 5 NM_004117 243 1215-1457 GGCTTGTATAGGAGGGGTGA AGTCTTCTTGCCCATTGCTT FLJ35220 hypothetical protein FLJ35220 NM_173627 214 1717-1930 TGTCCATCCCTGAGTCAGTT GAGGACTCTCCCAAAACCAT FLT3-1 fms-related tyrosine kinase 3 NM_004119 214 2970-3183 CGGAATGTCCTCACACCTAC TGGTGAAGCAGCAGTTGATA FLT3-2 fms-related tyrosine kinase 3 NM_004119 190 3608-3797 AGAGCACGTGTGCTTTTACC TACTTCTGACTGGCCCTGAG FLT3-3 fms-related tyrosine kinase 3 NM_004119 214 1604-1817 AAAGGGTTCCTGGTCAAGTG CCATCTGTAGCTGGCTTTCA FLT3-4 fms-related tyrosine kinase 3 NM_004119 223 2881-3103 GCCATCCTTCCCTAATTTGA TAGGTGGAGGGATGAAGTCC FLT3-5 fms-related tyrosine kinase 3 NM_004119 193 1460-1652 CCATCTTGGACCTGGAAGAA AAGATGTGCCAAGGGAATTG FLT3-6 fms-related tyrosine kinase 3 NM_004119 177 684-860 CACAGGGGGAAAGCTGTAAA ATTGTGGCAATGTGGTCTGA FLT3-7 fms-related tyrosine kinase 3 NM_004119 218 2543-2760 CACGGGAAAGTGGTGAAGAT GGAATGCCAGGGTAAGGATT FLT3-8 fms-related tyrosine kinase 3 NM_004119 172 1308-1479 ATAAGCACCAGCCAGGAGAA TTCTTCCAGGTCCAAGATGG FLT3-9 fms-related tyrosine kinase 3 NM_004119 236 1088-1323 CCCAGTCAATCAGCTTTGGT CCTGGCTGGTGCTTATGATT FMO2 flavin containing monooxygenase 2 NM_001460 162 24-185 TTAAAAACGCTTCCAACTGC TCCACACAGCACTTCAGAGA FMO2 flavin containing monooxygenase 2 NM_001460 208 618-825 AGGCCAATATTTCCATAGCC GTGGAACACTGAGTCCCAAG FMO2 flavin containing monooxygenase 2 NM_001460 210 1054-1263 TTTGAGGATGGAACAGTGGA AGCAGTTGGGAAAATGGAAC FMOD fibromodulin NM_002023 161 2372-2532 TGTTTCACCTGGTTTGTCCT GCAAAAGCCACCTTCACTAA FMOD fibromodulin NM_002023 215 876-1090 AGCAGCTGTACATGGAGCAC GAGGTTCTCCAGGTTGGTGT FNIP1 folliculin interacting protein 1 NM_133372 231 5652-5882 GCTGGTCTTGAACTCCTGAA ATGAGCCACCCACTTATTGA FNIP1 folliculin interacting protein 1 NM_133372 212 931-1142 CAGCTTGCTGATCACTCCAT CCCCAATTGCAATCTTCTTT FNIP1 folliculin interacting protein 1 NM_133372 FNIP1 folliculin interacting protein 1 NM_133372 FOLH1 folate hydrolase 1 NM_001014986 298 101-398 AACTGGACCCCAGGTCTGGA GAGGATTTTATAAACCACCCGAA FOLH1 folate hydrolase 1 NM_001014986 113 1458-1570 GAGGAGCTTTGGAACACTGA CCTCTGCCCACTCAGTAGAA FOLH1 folate hydrolase 1 NM_001014986 246 995-1240 GTTGGAATCTTCCTGGAGGT AGGGCACTTTGAGACTTCCT FOLH1 folate hydrolase 1 NM_001014986 216 1352-1567 GAGCAGTGGAACCAGACAGA CTGCCCACTCAGTAGAACCA FOLH1 folate hydrolase 1 NM_001014986 245 1799-2043 GCAAATTGGGATCTGGAAAT AGGGAGCACTATGGAATTGG FOLH1 folate hydrolase 1 NM_001014986 179 531-709 TCAGCTTGCAAAGCAAATTC CTGGAGGAGGTGGTTCAAAT FOXD3 forkhead box D3 NM_012183 192 403-594 CCCAAGAACAGCCTAGTGAA GCAGTCGTTGAGTGAGAGGT FOXO1A forkhead box O1A (rhabdomyosarcoma) NM_002015 281 5137-5417 CAATGGAACATCCCAAGAAG CAAGGAGAGGCCAACTGTAA FOXO1A forkhead box O1A (rhabdomyosarcoma) NM_002015 273 3879-4151 TTCAGATGGGTAGCAAATGG TTGTGATGACTTTGGGCTTT FOXO3A forkhead box O3A (FOXO3A), transcript variant 1 NM_001455 197 GTGTGTTTCCGGTTCTGAGT ATTTGGCAATGAGTGGAGAG FOXO3A forkhead box O3A (FOXO3A), transcript variant 1 NM_001455 171 2361-2533 GCTGAAGGATCACTGAGGAA CAGTCTCTGCTGGGTTAGGA FOXO4/MLLT7 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 7 NM_005938 284 2709-2994 GTCCCCTCATTCCTTCAACT GCCACACACACTTCCACATA FOXO4/MLLT7 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 7 NM_005938 172 ATGGAGAACCTGGAGTGTGA GAGGGCTCAAGGGTAAAGAG FOXP1 forkhead box P1 NM_032682 157 3563-3719 GGGTGTTTCGGATTTTCTTT CCAAGGCCATATTGTCAGTC FRAP1 FK506 binding protein 12-rapamycin associated protein 1 NM_004958 160 1228-1387 ATTTGATCAGGTGTGCCAGT GCTTAGGACATGGTTCATGG FREQ frequenin homolog NM_014286 234 1058-1291 GACTGACAGATGGGGTGAAG CCCCACAAAAAGCACAATAC FREQ frequenin homolog NM_014286 175 3624-3798 CCTGTCCTCTTCCTCGTAGC GGCTGTCAAACTGAAAAGCA FSCN1 fascin homolog 1, actin-bundling protein NM_003088 234 1242-1475 CCTCATGAAGCTCATCAACC TCGAAGAAGAAGTCCACAGG FSCN1 fascin homolog 1, actin-bundling protein NM_003088 221 1711-1931 AAACTGGAAACCCCAGAGAA GCCGCTTCCAGAGAAATAAG G0S2 G0/G1switch 2 NM_015714 187 517-703 CAGAGACAGACCGAGAAGGA ACAGCAGCAAAACTCAATCC G0S2 G0/G1switch 2 NM_015714 155 721-875 TCAGAGAAACCGCTGACATC CCTCCCTAGTGCAAAATGGT G6PC glucose-6-phosphatase, catalytic subunit NM_000151 279 CTGGTGGGTTTTGGATACTG GGAAAATGAGCAGCAAGGTA G6PC glucose-6-phosphatase, catalytic subunit NM_000151 249 GATTTCGGTGCTTGAATGTC GTCCCTTGAGCAGCAGATAA G6PC glucose-6-phosphatase, catalytic subunit NM_000151 176 GACTACAGGTGCAAGCCACT GAGGAGGCTGAGACATGAGA G6PC glucose-6-phosphatase, catalytic subunit NM_000151 295 TATCCCAAGCCAACCAAGAG AGGTTGCAGTGAGCCAAGAT G6PC glucose-6-phosphatase, catalytic subunit NM_000151 243 TGCACGTCTTTGACTCCTTG ATACCAGTGCCCATTGCTTC G6PC glucose-6-phosphatase, catalytic subunit NM_000151 154 75-228 TGAGGATGGAGGAAGGAATG CAGATGGGGAAGAGGACGTA GABARAP GABA(A) receptor-associated protein NM_007278 223 388-610 ACCAGGAACACCATGAAGAA AGAGAGGCTGGAGAGAAAGC GABARAPL1 GABA(A) receptor-associated protein like 1 NM_031412 191 869-1059 GGGGTTTAATTGTTGTGCAG CTCTTTTGGTCCCCAGGTAT GABARAPL1 GABA(A) receptor-associated protein like 1 NM_031412 173 801-973 TGTCAGGACAGAGCTGTTGG CAAAGAGAAGGGAGCACAGG GABARAPL1 GABA(A) receptor-associated protein like 1 NM_031412 229 1344-1572 TTATCTCACCCCTTCCTTGG GCCATCATGTAGCATTCCTG GABARAPL2 GABA(A) receptor-associated protein-like 2 NM_007285 203 505-707 CTAGGTGCACCGTAACTGCT CATGAGGACAATGCACAAAA GABBR1 gamma-aminobutyric acid (GABA) B receptor, 1 NM_001470 249 1009-1257 ATGTGGAACCTCATTGTGCT CTGGCGGAAAGTAATCTCAA GABRB3 gamma-aminobutyric acid (GABA) A receptor, beta 3 NM_000814 227 4940-5166 ACTCCCTGAAAGGCACTTCT TCAAGCCAGGAGATTCAAAG GADD45A-5 Growth arrest and DNA-damage-inducible, alpha NM_001924 115 202-316 TGAGTGAGTGCAGAAAGCAG CGAGAATTCCTCCAAAGTCA GADD45A-6 Growth arrest and DNA-damage-inducible, alpha NM_001924 187 322-508 AGAGCAGAAGACCGAAAGGA CAGAGCCACATCTCTGTCGT GADD45A-7 Growth arrest and DNA-damage-inducible, alpha NM_001924 234 749-982 TACATGGATCAATGGGTTCC TTTCACCTCTTTCCATCTGC GADD45B growth arrest and DNA-damage-inducible, beta NM_015675 170 687-856 CTCTCTTCAGGAACGCTGAG TTCCTCTTCAGTCTCCAACG GAL galanin prepropeptide NM_015973 236 433-668 TGAAACCAGGAAGCTTTGAC AAATTGGCCGAAGATTATCC GAL galanin prepropeptide NM_015973 156 303-458 AAGGAAAAACGAGGCTGGAC GGACCTGTCAAAGCTTCCTG GAL galanin prepropeptide NM_015973 222 479-700 GCGCACAATCATTGAGTTTC GGCAAAGAGAACAGGAATGG GALT galactose-1-phosphate uridylyltransferase NM_000155 206 881-1086 CGTGATGATCTAGCCTCCAT TCGTAGCCAACCATGAATTT GALT galactose-1-phosphate uridylyltransferase NM_000155 224 677-900 CGATCTCAGCAGGCCTATAA ATGGAGGCTAGATCATCACG GALT galactose-1-phosphate uridylyltransferase NM_000155 177 316-492 AGAGGTGAATCCCCAGTACG ATGAGTGGCAGCGTTACATC GAP43 growth associated protein 43 NM_002045 265 ACCCTCTTCTCAGCTCCACT CACACGCACCAGATCAAATA GAP43 growth associated protein 43 NM_002045 218 GACCAAGAACATGCCTGAAC ACTTGGGATCTTTCCTGCTT GAP43 growth associated protein 43 NM_002045 159 49-208 GAGAGAAGGCAGGAAGAAGG CTAGCCTGAATTTTGGTTGC GAPD Glyceraldehyde-3-phosphate dehydrogenase NM_002046 249 241-489 GGAAGGACTCATGACCACAG TTGGCAGGTTTTTCTAGACG GAPD Glyceraldehyde-3-phosphate dehydrogenase NM_002046 113 148-260 TGACAACAGCCTCAAGATCA CTGTGGTCATGAGTCCTTCC GAPD Glyceraldehyde-3-phosphate dehydrogenase NM_002046 201 278-478 ACCCAGAAGACTGTGGATGG TTCTAGACGGCAGGTCAGGT GAS1 growth arrest-specific 1 NM_002048 238 593-830 CAGCTACGCCTACAACCAGT CTTGGTGGACTTGCAGTTCT GAS1 growth arrest-specific 1 NM_002048 1650 2393-2560 GGGGTTTGTTACCAGTTGCT TGGGTTTTGATTCCTGATGA GATA1 GATA binding protein 1 NM_002049 186 334-519 CTTTCAGGTGTACCCATTGC AAAGTCTCCAGGAAGCTGGT GATA1 GATA binding protein 1 NM_002049 207 660-866 CAGCCTATTCCTCTCCCAAG TACTGACAATCAGGCGCTTC GATA1 GATA binding protein 1 NM_002049 210 847-1056 GAAGCGCCTGATTGTCAGTA TTTTTCCCTTTTCCAGATGC GATA2 GATA binding protein 2 NM_032638 273 2760-3032 GCTTTGCAATTCTTTTTGGA CAGAATCTAAGCTCGGGACA GATA2 GATA binding protein 2 NM_032638 157 1997-2153 GCATGGACAGTTGTTTGGAG ACCACCAAGTCTCCAAGTCC GATA2 GATA binding protein 2 NM_032638 232 977-1208 GTCACTGACGGAGAGCATGA GCCTTCTGAACAGGAACGAG GATA4 GATA binding protein 4 NM_002052 219 2974-3192 TCCTGGAAAGAAGACGACTG GATTTTGGAGTGAGGGGTCT GATA4 GATA binding protein 4 NM_002052 217 1916-2132 GACCTGGGACTTGGAGGATA ACAGGAGAGATGCAGTGTGC GATA4 GATA binding protein 4 NM_002052 258 2452-2709 CACTTAACCCACCACAGCAC TATGTGTGACACGGTGAACG GATA6 GATA binding protein 6 NM_005257 206 1658-1863 TGCAATGCTTGTGGACTCTA GTGGGGGAAGTATTTTTGCT GBL G protein beta subunit-like NM_022372 170 1449-1618 CGGTCCATAGAGAACACCAC CGTGTCGGTCTGCTTTTATT GBL G protein beta subunit-like NM_022372 210 569-778 GGCTATCCACATCTGGGACT GTGTGGGCAGGGATCTTAGT GBL G protein beta subunit-like NM_022372 211 307-517 AGCACATCCGCATGTATGAT CAGTTAATGGGTGCGTTCAC GBX2 gastrulation brain homeobox 2 NM_001485 240 827-1026 GAAGGAGTTCCACTGCAAAA AGCTGCTGATGCTGACTTCT GCK-1 BC001890 291 1501-1791 ACCGCAAGCAGATCTACAAC ACTCGATGAAGGTGATCTCG GCK-2 BC001890 262 1027-1289 GAGACGCTATCAAACGGAGA TACTCCAGCAGGAACTCGTC GCK-3 BC001890 198 GTGAAGGTGGGAGAAGGTG CACAGGAAAGGAGAAGGTGA GCM1 glial cells missing homolog 1 NM_003643 161 1216-1376 AACCCTTTTACCAGCAGCTT GGGGTCTTCTTGAGGTGAAT GDF15 growth differentiation factor 15 NM_004864 172 50-221 GTGAATGGCTCTCAGATGCT TGGTTAGCAGGTCCTCGTAG GDF15 growth differentiation factor 15 NM_004864 213 NYO CGCTCCAGACCTATGATGAC CAAGAAGGTCACCCCAATAA GDF15 growth differentiation factor 15 NM_004864 150 39-188 GGGCAAGAACTCAGGACGG TCTGGAGTCTTCGGAGTGCAA GFAP glial fibrillary acidic protein NM_002055 290 1472-1761 TAGGCTCCGTCAGTATCAGG GTCTCAGTTTTCCTCCAGCA GFAP glial fibrillary acidic protein NM_002055 266 2277-2542 CGCTGGTAGAGATGGAGGAG CTGGGGTTAAGAAGCAGCAG GFAP glial fibrillary acidic protein NM_002055 208 1447-1654 CTGTCCCTAGGTCAGCTTGC GATGTGGAGGGCGATGTAGT GFAP glial fibrillary acidic protein NM_002055 153 1215-1367 caacctgcagattcgagaaa gtcctgcctcacatcacatc GFAP glial fibrillary acidic protein NM_002055 217 326-542 tcctggaacagcaaaacaag aggttggtttcatcctggag GFAP glial fibrillary acidic protein NM_002055 183 2567-2747 gggactgctgcttcttaacc tgctcgtgcctcagttttac GFI1B growth factor independent 1B transcription repressor NM_004188 220 1123-1342 GAGCCAGCACAATCTCAAGT GCAGCAGGAGAAATGTTGAT GFI1B growth factor independent 1B transcription repressor NM_004188 205 276-480 ACAGCCCTGTCCTTAGCACT GTGTCCCAGGAGAAGCTAGG GFI1B growth factor independent 1B transcription repressor NM_004188 159 490-648 AACCTATGGCCACAGCTACC ACACAGTGGTACGCATCCAT GFPT1 glutamine-fructose-6-phosphate transaminase 1 NM_002056 232 2349-2580 TCCCAGTAATTTGTGGAGGA CACTGCCACTGGCTTTAGAT GFPT1 glutamine-fructose-6-phosphate transaminase 1 NM_002056 188 2078-2265 TTTACAGTTGCTGGCTTTCC GGCTTCAAGGGGTGATATTT GFPT1 glutamine-fructose-6-phosphate transaminase 1 NM_002056 157 529-685 TGGAAAGCAAAGGCTATGAC ACAAGTGCAAAAGCACCTTC GJA1 gap junction protein, alpha 1, 43kDa NM_000165 154 1589-1742 AGGGAGGGGATAAGAGAGGT CCGCTCATTCACATACACAG GJA1 gap junction protein, alpha 1, 43kDa NM_000165 295 2749-3043 CTTTTGGAGTGACCAGCAAC TGAAGCTGAACATGACCGTA GJA5 gap junction protein, alpha 5, 40kDa NM_181703 226 AAGAAGCTGTTGTCCCCTCT CTTGGCACTAAGTTGGCAGT GJA5 gap junction protein, alpha 5, 40kDa NM_181703 254 AGAACACAGACAGGCAGAGG GTATCACACCGGAAATCAGC GJA5 gap junction protein, alpha 5, 40kDa NM_181703 173 1811-1984 GCAGCCTCAGCTTTACAAATG GTGACAGATGTTGGCAGGAAT GJA5 gap junction protein, alpha 5, 40kDa NM_181703 132 CCCTAGTGCCCCTAATGAGAC GCATCGTTTACCTTCATCCAA GJA5 gap junction protein, alpha 5, 40kDa NM_181703 118 TAATCAGTGCCTGGAGAATGG CTGCTCCTGACCTCGTACTTG GJA7 gap junction protein, alpha 7, 45kDa NM_005497 226 GTGGGTTTGGTTCATGTGTT GAGAGGGGGTTTTACCATGT GJA7 gap junction protein, alpha 7, 45kDa NM_005497 188 4611-4799 TCTCACTCGCATCAGAATCA AAGAGCAAAGGACACACCAC GJC1 gap junction protein, gamma 1, 45kDa NM_005497 232 1131-1362 CTCCCCCTGGCTATAACATT TGAGGGTTGTTTTGGTGACT GLI1-4 glioma-associated oncogene homolog 1 NM_005269 217 2025-2241 TGCTCCAGCTAGAGTCCAGA ATAGGGGTTCAGACCACTGC GLI1-5 glioma-associated oncogene homolog 1 NM_005269 226 1903-2128 CTGGATCGGATAGGTGGTCT CAGAGGTTGGGAGGTAAGGA GLI1-6 glioma-associated oncogene homolog 1 NM_005269 248 389-636 GCTCCCTCGTAGCTTTCATC CAGCATGTCCAGCTCAGACT GLI3 GLI family zinc finger 3 NM_000168 250 3920-4169 CAAGCCTCAAAGCTGAAGAG GCCCTTGGTAGATGTTGATG GLI3 GLI family zinc finger 3 NM_000168 197 4601-4797 ATTGACTTCGATGCCATCAT AGGGAGGTCAGCAAAGAACT GLI3 GLI family zinc finger 3 NM_000168 165 7242-7406 TCAGCTCAATGTTTGGCTTC GGATGTCCCAAAAAGATGCT GLRX glutaredoxin NM_002064 71 318-388 GATTGGAGCTCTGCAGTAACCA CAATGCCATCCAGCTCTTGA GLRX glutaredoxin NM_002064 219 949-1167 AGGACCCAATTGGAGAAATC GGTGTAGGGGGCTGTAAGTT GLRX glutaredoxin NM_002064 157 895-1051 CCTTGTCCTCCACACATCTC TAACAGAGTGTTCCGCATGA GLRX glutaredoxin NM_002064 177 247-423 GATTGTATAGGCGGATGCAG CCAAATTCATCCACCAGAAG GLRX glutaredoxin NM_002064 219 1146-1364 AGGACCCAATTGGAGAAATC GGTGTAGGGGGCTGTAAGTT GLRX-3 glutaredoxin NM_002064 232 42-273 TGGAAATGTCTTCGAAGCTG GGCTTGATGAACACAACCAC GNAI3 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 NM_006496 207 3133-3339 GGATCCTGGAAATGAGACCT ATGGGGACCTGCTATTTTTC GOLSYN Golgi-localized protein NM_001099744 164 1171-1334 CATCCCAGTTATGCACCTTC TGCTGCAGTGGAGTCAAATA GPC4 glypican 4 NM_001448 185 1358-1542 GGACCGACTGGTTACTGATG GGTTGGCTAATCCATTTCCT GPC5 glypican 5 NM_004466 240 1249-1488 TATATCCGGTCGTTGGAAGA CCTTGTGGTGGTCTTCATTC GPC5 glypican 5 NM_004466 230 681-910 TGCTTTTCAAGAAACCCTTG CAGGGTTAATGAGGTGGTTG GPC5 glypican 5 NM_004466 207 1593-1799 ATTAGCTGCTGCAGATGGAC TTGTCAGGTTTGGGTGATCT GPNMB glycoprotein (transmembrane) nmb NM_001005340 216 520-735 GCAGAAATGAGGCTGGTTTA CTGAACATCGTCCCAATTTC GPNMB glycoprotein (transmembrane) nmb NM_001005340 203 1514-1716 GCTGACTGTGAGACGAACCT ACACCAAGAGGGAGATCACA GPNMB glycoprotein (transmembrane) nmb NM_001005340 208 819-1026 TATGTTCCCATCGCACAAGT TATTATCCCCGAAGCTCCAC GPSM1 G-protein signaling modulator 1 NM_015597 172 189-360 GGAATACCACAAGCATGACC AACCTTGTCTCCCTGCTCTT GPSM1 G-protein signaling modulator 1 NM_015597 168 108-275 CGAGGACCTGAAGACACTGA GTGTTTCCCAGGTTTCCACT GPSM1 G-protein signaling modulator 1 NM_015597 212 746-947 ACAAGAAGACGCTGCAACTG CATGGACACGTAGGCATTTC GPSM1 G-protein signaling modulator 1 NM_015597 171 1282-1452 AGGAGCAGGAAGTACCAGGA GCTCTGGAACTTGGTCAACA GPSM1 G-protein signaling modulator 1 NM_015597 174 592-765 TTGTTGGGGAACTTCACAGA CAGTTGCAGCGTCTTCTTGT GPSM1 G-protein signaling modulator 1 NM_015597 198 1100-1297 CCTCAGAGAAGCCTGACCTG GGTACTTCCTGCTCCTCACG GPSM1 G-protein signaling modulator 1 NM_015597 312 1430-1741 ACCTGTTGACCAAGTTCCAG TGAGCATGTTGAAGAAGTCG GPSM1 G-protein signaling modulator 1 NM_015597 316 804-1119 CTGCTACAGTCTGGGCAACA CAGGTCAGGCTTCTCTGAGG GPSM1 G-protein signaling modulator 1 NM_015597 266 406-671 AAAGGCAAGCAACTGTCCTG GCTGCCTTGTCTCCAAACTC GPSM2 G-protein signaling modulator 2 NM_013296 196 957-1152 CCAAAGGGAAAAGTTTTGGT CTGAAGTTGCCAAGGAGGTA GPSM3 G-protein signaling modulator 3 NM_022107 179 151-329 ATTTTGTGCTTTTGGCTCAG GGGAAGTGGAGGATTCAGAT GPSM3 G-protein signaling modulator 3 NM_022107 175 1007-1181 ACTGGACAGGGTGAAAGTCC CTTGACAACTGGTGGTGTCC GPSM3 G-protein signaling modulator 3 NM_022107 184 5-188 AGCGGGGATCACCTTAACTT CTCCATCCAATCCAAATGCT GRB7 growth factor receptor-bound protein 7 NM_005310 189 89-277 ACCTGTAGAGAAGCGGGAGT ATGAGGTGGAGACAGATCCA GRHL2 grainyhead-like 2 NM_024915 150 1752-1901 ccactcacagccagttctct ggaccaaactcctcttccat GRN granulin NM_002087 144 870-1013 TGGTTCTACCTGCTGTGAGC TTCTCCTTGGAGAGGCACTT GRN granulin NM_002087 272 1525-1796 TTATCCCACCCCAGAGACAT AAGTGTCCTTCCCCACACTC GSTM5 glutathione S-transferase mu 5 NM_000851 152 705-856 TCAGCTACATGGAACAGCAA CCTTGGGGAAGAGAAGAGAG GSTM5-3 glutathione S-transferase mu 5 NM_000851 273 983-1255 CCTGACTGCTTTTCCTGTCA CACACACCCATCCACTAAGC GSTO1 glutathione S-transferase omega 1 NM_004832 159 557-715 GGCTGGAAGCAATGAAGTTA CCTCAGGGCTGTTCTGTAAG GSTO1 glutathione S-transferase omega 1 NM_004832 226 290-515 ATGAAGCATACCCAGGGAAG GAATTGCCACCAAAGAAGGT GTF2H3 general transcription factor IIH, polypeptide 3, 34kDa NM_001516 233 1083-1315 TTTCCCAAACATCCTTTTCA ATTTCGTATGGCATGCATTT GTF2H4 general transcription factor IIH, polypeptide 4, 52kDa NM_001517 220 939-1158 TCTGGGCAAGGATTACTCTG GGCATACAGTCGGTAATTGG GTF2H5 general transcription factor IIH, polypeptide 5 NM_207118 159 41-199 CAACGTCTTGAAAGGAGTGC TCCTGGAGGACATTAACCAA GTF2H5 general transcription factor IIH, polypeptide 5 NM_207118 159 41-199 CAACGTCTTGAAAGGAGTGC TCCTGGAGGACATTAACCAA GYLTL1B glycosyltransferase-like 1B NM_152312 206 1493-1698 TGTACCTGACAGACGCAGAA AGAATAGGCAGGCAGGAAGT GYPC glycophorin C NM_002101 214 664-877 GAGATAGCCACCTGGAAACA ACCCTCAACAAGGACTTTCC GYPC glycophorin C NM_002101 183 510-692 TGGTGATAGCAGCAGAAAGG GGCACCTAGTGTTTCCAGGT H19 imprinted maternally expressed untranslated mRNA BC053636 163 1121-1283 AGAAGCGGGTCTGTTTCTTT TGCAGCATATTCATTTCCAA H2AFX H2A histone family, member X NM_002105 224 290-513 GACAACAAGAAGACGCGAAT GGGCCCTCTTAGTACTCCTG HAND1 heart and neural crest derivatives expressed 1 NM_004821 230 368-597 GAAAGGCCCTACTTCCAGAG AATGCGCTGTTAATGCTCTC HAND1 heart and neural crest derivatives expressed 1 NM_004821 251 1208-1458 TCAAAGACGCACTCTTCCAC GTGCAGCGACAAAAAGAAAA HAND1 heart and neural crest derivatives expressed 1 NM_004821 220 1413-1632 TTCGAATCGTGGTGGTTTTA GCAGGATGAACAAACACCTG HAS3 hyaluronan synthase 3 NM_005329 207 250-456 GGCTACCAGTTCATCCACAC GTAGTCAGGGTCCTCCTGGT HAS3 hyaluronan synthase 3 NM_005329 219 1132-1350 AGCCTTGGCTACCGAACTAA TATAACCGTGGCAATGAGGA HBB hemoglobin, beta NM_000518 190 319-508 GTGAGCTGCACTGTGACAAG GCAAGAAAGCGAGCTTAGTG HBB hemoglobin, beta NM_000518 211 250-460 AAGTGCTCGGTGCCTTTAGT CCAGCCACCACTTTCTGATA HBB hemoglobin, beta NM_000518 238 194-431 TCTGTCCACTCCTGATGCTG CACTGGTGGGGTGAATTCTT HBZ hemoglobin, zeta NM_005332 297 176-472 AAGACCTACTTCCCGCACTT CTCGGTCAGGACAGAGGATA HBZ hemoglobin, zeta NM_005332 210 76-285 GAGGACCATCATTGTGTCCA ATGTCGTCGATGCTCTTCAC HBZ hemoglobin, zeta NM_005332 152 428-579 GCCTGGGACAAGTTCCTATC TTGGTTTATTGGCGCATTAC HCN1 hyperpolarization activated cyclic nucleotide-gated potassium channel 1 NM_021072 254 4155-4508 GTGACAGAAAGCAGGGGTAA ATTGCCAGTGCCAGAGATAC HCN1 hyperpolarization activated cyclic nucleotide-gated potassium channel 1 NM_021072 185 ACTTTCCGTGGACAATTTCA TCTGCTTGAGGATTTCGTTC HCN2 hyperpolarization activated cyclic nucleotide-gated potassium channel 2 NM_001194 190 GACAACTTCAACGAGGTGCT GGTCGTACTTGACGATCTCC HCN2 hyperpolarization activated cyclic nucleotide-gated potassium channel 2 NM_001194 266 GCAAGATGTTTGACGAGGAC CTCCTTGTTGCCCTTAGTGA HCN2 hyperpolarization activated cyclic nucleotide-gated potassium channel 2 NM_001194 229 CCGAGGAGGATCGTTTTCTAA CGGCTCGTCAGTACATTCATC HCN2 hyperpolarization activated cyclic nucleotide-gated potassium channel 2 NM_001194 120 1729-1853 AGCTCAAGTTCGAGGTCTTCC TCTCCTTGTTGCCCTTAGTGA HCN4 hyperpolarization activated cyclic nucleotide-gated potassium channel 4 NM_005477 290 CCCGTTAGCTGTAACTTGGA CATCCTGTCAACATGGGATT HCN4 hyperpolarization activated cyclic nucleotide-gated potassium channel 4 NM_005477 288 CTACAGGACTTCCCTGACGA GTACTGCTCCACCTGCTTGT HCN4 hyperpolarization activated cyclic nucleotide-gated potassium channel 4 NM_005477 125 1381-1506 TGATGGTGGGAAACCTGATTA GTTGAGGACCAAGTCGATGAG HCN4 hyperpolarization activated cyclic nucleotide-gated potassium channel 4 NM_005477 298 TTTAACTGTCGGAAGCTGGTG AGTAGAGGCGGCAGTAGGTGT HDAC1 Histone deacetylase 1 NM_004964 226 CTCTGGCTTCCTGCTGAGT AGACCTGGCACCCTTTATG HDAC2 Histone deacetylase 2 NM_001527 273 GACAGTGGAGATGAAGATGGA TTCTGATTTGGTTCCTTTGG HDC histidine decarboxylase NM_002112 251 437-651 GCGTGTACAGAGCTGGAGAT TTTAGGCAGGACTCATCAGC HEL308 DNA helicase HEL308 NM_133636 167 840-1006 AGGGATTGGAAGTCATCCTC TTTCCAGTCATGGCATTTTT HEL308 DNA helicase HEL308 NM_133636 248 1566-1813 GACGAGTTGCACATGATTGG ATGCCATTCTCAGCTTTGCT HEL308 DNA helicase HEL308 NM_133636 278 1311-1588 CTTTGCTGTCGGAAAGATGT TCACCAATCATGTGCAACTC HEL308 DNA helicase HEL308 NM_133636 284 2158-2441 CCACAGGAGTGCTCTGTCTT GATTCCCTTGGTGAATTCCT HES1 hairy and enhancer of split 1 NM_005524 235 38-272 AATCCCCCGTCTACCTCTCT GGACGAGGAATTTTTCTCCA HES1 hairy and enhancer of split 1 NM_005524 186 1121-1306 CTCTCTTCCCTCCGGACTCT AGGCGCAATCCAATATGAAC HES1 hairy and enhancer of split 1 NM_005524 155 534-688 CTGAGCACAGACCCAAGTGT TTGATCTGGGTCATGCAGTT HES1 hairy and enhancer of split 1 NM_005524 182 317-498 ACCAAAGACAGCATCTGAGC GGTGCTTCACTGTCATTTCC HES1 hairy and enhancer of split 1 NM_005524 175 392-566 AAGTCTGAGCCAGCTGAAAA GTACTTCCCCAGCACACTTG HES1 hairy and enhancer of split 1 NM_005524 223 670-892 ACTGCATGACCCAGATCAAT AAGCCTCCAAACACCTTAGC HIF1A hypoxia-inducible factor 1, alpha subunit NM_001530 164 947-1110 GCTGATTTGTGAACCCATTC AAATTGAGCGGCCTAAAAGT HIF1A hypoxia-inducible factor 1, alpha subunit NM_001530 167 1526-1692 CAGCAACGACACAGAAACTG GTGCAGGGTCAGCACTACTT HIG2 hypoxia-inducible protein 2 NM_013332 167 1003-1169 TGTATGCTGTGCTTTCCTCA GAAGAGAGGCTCAACACCAA HIG2 hypoxia-inducible protein 2 NM_013332 163 391-553 AAGCCAACTAGCCAACACAG GTTACAACGGTGCTCAGCTT HIG2 hypoxia-inducible protein 2 NM_013332 189 934-1122 ATGCACAGGTGTGAGTGGAT AAAGGAACCCCAGACAGATG HK2-1 NM_000189 209 4695-4506 TCAAAGTGACAGTGGGTGTG CCGATTTCAGGGGTTCTATC HK2-2 NM_000189 221 3195-3415 TGCCAAGCGTCTACATAAGA GCTCCATTTCTACCTTCATCC HK2-3 NM_000189 153 1979-2132 AAGTGCAGAAGGTTGACCAG CTCACAAAGGTGGGCAGCAT HLA-A-ex2-1 NC_000006 185 ATTTCTTCACATCCGTGTCC CTTCACATTCCGTGTCTCCT HLA-A-ex2-2 NC_000006 216 CAGGTTCTCACACCATCCA CATCCAGGTAGGCTCTCAAC HLA-A-ex5-1 NC_000006 154 TGTGCTATGGGGTTTCTTTG CAACTCTTGCCTCTCAGTCC HLA-A-ex5-2 NC_000006 202 GGGACTGAGAGGCAAGAGTT GGAACAGGAAAGATGATTGG HLA-DRB1 major histocompatibility complex, class II, DQ beta 1 NM_002123 236 830-1065 ATCATCCGTCAAAGGAGTCA GTCAGTGCAGGAAGCAGAGT HLA-DRB1 major histocompatibility complex, class II, DQ beta 1 NM_002123 213 650-862 CTGGTGATGCTGGAAATGAC CAGAAGCCCTTTCTGACTCC HLA-DRB1 major histocompatibility complex, class II, DQ beta 1 NM_002123 178 850-1027 GAAAGGGCTTCTGCACTGAC GTGGGGATGAAAGGAGATGA HLA-DRB3 major histocompatibility complex, class II, DR beta 3 NM_022555 202 701-902 TCTGAATCTGCACAGAGCAA GAAAGCTTTTCATCCTGCAA HLA-DRB3 major histocompatibility complex, class II, DR beta 3 NM_022555 231 593-823 CAGACCCTGGTGATGCTAGA TGGCTGAAGTCCAGAGTGTC HLA-DRB3 major histocompatibility complex, class II, DR beta 3 NM_022555 150 834-983 TGAGCTGAAGTGCAGATGAC GGACATTTTCTGCAGTTGCT HMBS hydroxymethylbilane synthase NM_000190 163 418-580 GAATGAAGTGGACCTGGTTG ACTCTTCTCTGGCAGGGTTT HMBS hydroxymethylbilane synthase NM_000190 278 974-1251 GATGGGCAACTGTACCTGAC CAAACCAGTTAATGGGCATC HMBS hydroxymethylbilane synthase NM_000190 262 1082-1343 CCTGAGGATGACCCACAGTT GGGGTAATCACTCCCCAGAT HMGA2 high mobility group AT-hook 2 NM_003483 80 947-1026 TAAGAGACCCAGGGGAAGAC CAGTGGCTTCTGCTTTCTTT HMGA2 high mobility group AT-hook 2 NM_003483 111 913-1023 AGCAGCAGCAAGAACCAAC TGGCTTCTGCTTTCTTTTGA HMGA2 high mobility group AT-hook 2 NM_003483 84 945-1028 CCTAAGAGACCCAGGGGAAG TCCAGTGGCTTCTGCTTTCT HMGCR 3-hydroxy-3-methylglutaryl-Coenzyme A reductase NM_000859 231 2952-3182 CTTGGTTTTTGGCTCTTTCA GTCAATTGCACTGATCACCA HMGCR 3-hydroxy-3-methylglutaryl-Coenzyme A reductase NM_000859 224 2419-2642 AACATTGTCACCGCCATCTA TCTTTGCATGCTCCTTGAAC HMGCR 3-hydroxy-3-methylglutaryl-Coenzyme A reductase NM_000859 228 2287-2514 GTCATTCCAGCCAAGGTTGT GGGACCACTTGCTTCCATTA HNRPAB heterogeneous nuclear ribonucleoprotein A/B NM_031266 163 1053-1215 CAGAGTTGGAATCAGGGCTA GGCTCTTGCCGTAGTTTGTA HNRPAB heterogeneous nuclear ribonucleoprotein A/B NM_031266 225 534-758 TTTGGAGAGGTCGTTGACTG CTCAGTGGCTTCAGGATTCA HOXA10 homeobox A10 NM_018951 192 1952-2143 GAAGGGGACTTCTCTTCCAG GAATTGTGGTGTGCTTGTCA HOXA10 homeobox A10 NM_018951 184 990-1173 CAATTCCAAAGGTGAAAACG TTTCACTTGTCTGTCCGTGA HOXA10 homeobox A10 NM_018951 234 1233-1446 GGAGCTCACAGCCAACTTTA AAATAAACCAGCACCAAGCA HOXA11 homeobox A11 NM_005523 151 1082-1232 ACAAAGTCAAGCCACATGGT ATGCACAGCTCTCAGAATCC HPSE-2 Heparanase NM_006665 167 249-415 GTCGTGGACCTGGACTTCTT CTCAGGTACGCAGGAGACAA HPSE-3 Heparanase NM_006666 239 990-1228 GCTGGTGGAGAAGTGATTGA ATAAAGCCAGCTGCAAAGGT HPSE-4 Heparanase NM_006667 213 846-1058 ATCAATGGGTCGCAGTTAGG CTTGGTAGCAGTCCGTCCAT HS3ST5 heparan sulfate (glucosamine) 3-O-sulfotransferase 5 NM_153612 159 1382-1540 CCCGCCATTTTCATAGATTT TCTGTTTTCATGGCACCAAT HTR1B-4 5-hydroxytryptamine (serotonin) receptor 1B NM_000863 171 208-378 GTGATTGCCACAGTGTACCG CAGCCAGAAGTCACAGACCA HTR1B-5 5-hydroxytryptamine (serotonin) receptor 1B NM_000863 248 708-955 CTCCCGGATTTTGAAACAGA TGATCCCTAGGGTCTTGGTG HTR1B-6 5-hydroxytryptamine (serotonin) receptor 1B NM_000863 210 842-1051 CCGGATCTCCTGTGTATGTG AGATGGCTAGGTGGAACCAG HTR2A-3 5-hydroxytryptamine (serotonin) receptor 2A NM_000621 162 1428-1589 TCAAAGCAAGATGCCAAGAC CTCAGTGTGCCTTCCACAGT HTR2A-4 5-hydroxytryptamine (serotonin) receptor 2A NM_000621 248 57-304 CATCAAGGTGAATGGTGAGC CAGGAAAGGTTGGTTCGATT HTR2A-5 5-hydroxytryptamine (serotonin) receptor 2A NM_000621 182 972-1153 TCTTTCAGCTTCCTCCCTCA AAGAAAGGGCACCACATCAC HTR2B-2 5-hydroxytryptamine (serotonin) receptor 2B NM_000867 199 1178-1376 GCCTTCTTCACACCTCTTGC TGTCCTTTCGAGAACCATCC HTR2B-3 5-hydroxytryptamine (serotonin) receptor 2B NM_000867 152 1139-1290 GAACGTTTTGGCGATTTCAT AACCATGTTAGGCGTTGAGG HTR2B-4 5-hydroxytryptamine (serotonin) receptor 2B NM_000867 217 535-751 TCAAAGCACAATTCCTGAGC CTCCAGTGAAACAGCCAGAA HTR3A-2 5-hydroxytryptamine (serotonin) receptor 3A NM_213621 249 330-578 CGTCATTGTCTATGCCATCC TTCTGAACTTCGCCTTGATG HTR3A-3 5-hydroxytryptamine (serotonin) receptor 3A NM_213621 197 719-915 AAAAGGTGAAATCCGACAGG CATGACCATGAGGAAGATGC HTR3A-4 5-hydroxytryptamine (serotonin) receptor 3A NM_213621 192 1633-1824 ACCCTGGTTATGCTCTGGTC CTGAGATGAATTGGCATTGG IBSP integrin-binding sialoprotein NM_004967 166 728-893 TGCAGAAGACACCACAGAGA GTATTCGTACTCCCCCTCGT ICAM1 intercellular adhesion molecule 1 NM_000201 232 2376-2607 TTTTCTATCGGCACAAAAGC AATGCAAACAGGACAAGAGG ICAM1 intercellular adhesion molecule 1 NM_000201 200 CCCGAGCTCAAGTGTCTAAA ATTATGACTGCGGCTGCTAC ICAM1 intercellular adhesion molecule 1 NM_000201 263 CTTGGGCACTGCTGTCTACT ATCACTCCTTCTGGGGAAAG ICAM1 intercellular adhesion molecule 1 NM_000201 291 GCAAGAAGATAGCCAACCAA CCATGGTGATCTCTCCTCAC ID3 inhibitor of DNA binding 3 NM_002167 203 934-1136 GCGAAGGACTGTGAACTTGT GCAACAGAACCTTTCTCCAA ID3 inhibitor of DNA binding 3 NM_002167 187 197-383 GGAAGCCTGTTTGCAATTTA GCCCCAAAGAGAAAGAAAAC ID3 inhibitor of DNA binding 3 NM_002167 156 135-290 ATCAGCGCTTCCTCATTCTT GAAGGCACGCCTCTTTATTC ID3 inhibitor of DNA binding 3 NM_002167 213 749-961 GGAGCTTTTGCCACTGACTC TTCAGGCCACAAGTTCACAG IFNA2 interferon, alpha 2 NM_000605 275 TTGACCTTTGCTTTACTGGTG TCCTTTGTGCTGAAGAGATTG IFNA2 interferon, alpha 2 NM_000605 175 TCAATCTCTTCAGCACAAAGG TATTTCCTCACAGCCAGAATG IFNA2 interferon, alpha 2 NM_000605 294 GGATGAGACCCTCCTAGACAA TCATTTCCATGTTGAACCAGT IFNA2 interferon, alpha 2 NM_000605 207 633-839 TGAAAACTGGTTCAACATGG TAATGGATCAGTCAGCATGG IFNA2 interferon, alpha 2 NM_000605 182 GCAAGTCAAGCTGCTCTGTG GATGGTTTCAGCCTTTTGGA IFNA2 interferon, alpha 2 NM_000605 247 ACAGAGGACCATGCTGACTG GTTGCACAATTAGGCTTGGA IFNA2 interferon, alpha 2 NM_000605 107 ??? GCTATGACCATGACACGATT GTCAGCATGGTCCTCTGTAA IFNA2 interferon, alpha 2 NM_000605 119 AGGAATGAAAACTGGTTCAA TTTAAATCGTGTCATGGTCA IFNA2 interferon, alpha 2 NM_000605 390 TCGTATGCCAGCTCACCTTT GGTTGCACAATTAGGCTTGG IFNA2 interferon, alpha 2 NM_000605 332 105-436 GTGCTCAGCTGCAAGTCAAG ATCACACAGGCTTCCAGGTC IFNA2 interferon, alpha 2 NM_000605 344 25-368 GCTCACCCATTTCAACCAGT ATCCCAAGCAGCAGATGAGT IFNA21 interferon, alpha 21 NM_002175 165 TCCACTGAACTTAACCAGCAG AGCACAAGGGCTGTATTTCTT IFNA21 interferon, alpha 21 NM_002175 281 12-293 GCCCTGTCCTTTTCTTTACTG TCCTTTGTGCTGAAGAGATTG IFNA21 interferon, alpha 21 NM_002175 126 NYO CTGGTGCTCAGCTACAAATCC CAGGCAGGAGAAAGGAGAGAT IFNA21 interferon, alpha 21 NM_002175 234 TCCTTTACAGATGACCATGC GGGCTTGGAATTTCTTTATT IFNA21 interferon, alpha 21 NM_002175 111 CTCCTATAACCACCGCATGA CAGCATGGTCATCTGTAAAGG IFNA21 interferon, alpha 21 NM_002175 247 158-404 CTCCTGCCTGAAGGACAGAC AGTCTCTTCCACCCCAACCT IFNA21 interferon, alpha 21 NM_002175 226 9-234 ATGGCCCTGTCCTTTTCTTT CTTGAGCCTTCTGGAACTGG IFNA8 interferon, alpha 8 NM_002170 264 ATCCTGGCTGTGAGGAAATAC CAATTCATAGCATGGTTTTGG IFNA8 interferon, alpha 8 NM_002170 162 291-452 CTTCAACCTCTTCAGCACAAA AGGATGGAGTCCTCGTACATC IFNA8 interferon, alpha 8 NM_002170 188 NYO TAACAGGAGGGCCTTGATACT AGTCCTTTGTGCTGAAGAGGT IFNB1 interferon, beta 1, fibroblast NM_002176 185 ORDERED AGCACTGGCTGGAATGAGAC TCCTTGGCCTTCAGGTAATG IFNB1 interferon, beta 1, fibroblast NM_002176 186 80-265 CCAACAAGTGTCTCCTCCAAA CCTCAGGGATGTCAAAGTTCA IFNB1 interferon, beta 1, fibroblast NM_002176 122 TCTGGCACAACAGGTAGTAGG GCAAGTTGTAGCTCATGGAAA IGF2R insulin-like growth factor 2 receptor NM_000876 203 303-505 CATGGGAAGCTGTTGATACC CTGGTCACAGCTCACTGTTG IGF2R insulin-like growth factor 2 receptor NM_000876 172 3428-3599 TACGACCTGACTGGCCTAAG TCCAGCTATTGCCTTCTGAC IGF2R insulin-like growth factor 2 receptor NM_000876 210 2923-3132 GACAACGACGGATACAGACC TCTTCAGTTTGGGTTTCTGC IGF2R insulin-like growth factor 2 receptor NM_000876 166 3669-3834 GTGACAAGTGTGGGAACCAG ACCTCACAGTTGTCCCCTTC IGFBP7 insulin-like growth factor binding protein 7 NM_001553 182 690-871 GCCCAGAAAAGCATGAAGTA TTATAGCTCGGCACCTTCAC IGFBP7 insulin-like growth factor binding protein 7 NM_001553 187 585-771 CACCTGTCCTCATCTGGAAC GCATGGCACTCATATTCTCC IL10-4 Interleukin 10 NM_000572 155 1302-1456 TGGTGAAACCCCGTCTCTAC CTGGAGTACAGGGGCATGAT IL10-5 Interleukin 10 NM_000572 193 958-1150 AAGCCTGACCACGCTTTCTA ATGAAGTGGTTGGGGAATGA IL10-6 Interleukin 10 NM_000572 179 18-196 TCTTGCAAAACCAAACCACA TCTCGGAGATCTCGAAGCAT IL13RA2 interleukin 13 receptor, alpha 2 NM_000640 192 840-1031 TTGCCGCCAGTCTATCTTAC TCGGGTTTCATTTGTTGTTT IL13RA2 interleukin 13 receptor, alpha 2 NM_000640 208 459-666 CAATGCACAAATGGATCAGA CATGATCCAAGCCCTCATAC IL17RA interleukin 17 receptor A NM_014339 173 3232-3404 TGAAACCCCATCTCCACTAA AGTCTCGCTCTGTCATCCAG IL17RA interleukin 17 receptor A NM_014339 241 824-1064 CAGATCCTGCTGACCAGTTT CTGGAGTGTCTGGCATTTCT IL17RA interleukin 17 receptor A NM_014339 196 2340-2535 CTCCTGACCTCCTTCCAGAG GAGCTCCTGGAGATGTAGCC IL17RA interleukin 17 receptor A NM_014339 204 872-1075 GAGCACATGCACCACATACC CGGAATTGGTTCTGGAGTGT IL1A interleukin 1, alpha NM_000575 240 GCCTCAAGATGAAGGCAAAG GCAGAGTTTCCTGGCTATGG IL1A interleukin 1, alpha NM_000575 226 AATGACGCCCTCAATCAAAG TGGGTATCTCAGGCATCTCC IL1A interleukin 1, alpha NM_000575 185 GTAAGCTATGGCCCACTCCA GCCTCCAGGTCATCATCAGT IL1B interleukin 1, beta NM_000576 260 400-660 TTCGACACATGGGATAACGA TCTTTCAACACGCAGGACAG IL1B interleukin 1, beta NM_000576 210 AATGACCTGAGCACCTTCTTT CACCACTTGTTGCTCCATATC IL1B interleukin 1, beta NM_000576 154 NYO CTGGTACATCAGCACCTCTCA AGGGATTGAGTCCACATTCAG IL1B interleukin 1, beta NM_000576 176 351-526 TGACCTGAGCACCTTCTTTC GGTGGAGAGCTTTCAGTTCA IL1B interleukin 1, beta NM_000576 175 NYO AATCTCCGACCACCACTACA ATCCCATGTGTCGAAGAAGA IL1B interleukin 1, beta NM_000576 100 232-331 CAGCTACGAATCTCCGACCAC GGCAGGGAACCAGCATCTTC IL2 Interleukin 2 NM_000586 241 211-451 GAATCCCAAACTCACCAGGA TGCTGTCTCATCAGCATATTCA IL2 Interleukin 2 NM_000586 170 62-231 AGGATGCAACTCCTGTCTTG ATCCTGGTGAGTTTGGGATT IL2 Interleukin 2 NM_000586 183 262-446 GGCCACAGAACTGAAACATC TCATCAGCATATTCACACATGA IL2 Interleukin 2 NM_000586 154 305-458 AAACCTCTGGAGGAAGTGCT CAATGGTTGCTGTCTCATCA IL2 Interleukin 2 NM_000586 246 439-684 TGATGAGACAGCAACCATTG CCCCTAGGGCTTACAAAAAG IL2 Interleukin 2 NM_000586 140 17-156 TCCTGTCTTGCATTGCACTAAG CATCCTGGTGAGTTTGGGATTC IL2 Interleukin 2 NM_000586 227 38-264 ACCTCAACTCCTGCCACAAT GCCTTCTTGGGCATGTAAAA IL2 Interleukin 2 NM_000586 199 256-454 CAAGAAGGCCACAGAACTGA GGTTGCTGTCTCATCAGCAT IL2 Interleukin 2 NM_000586 162 157-318 GGAGCATTTACTGCTGGATT TCCTCCAGAGGTTTGAGTTC IL2 Interleukin 2 NM_000586 148 219-366 AACTCACCAGGATGCTCACATTTA TCCCTGGGTCTTAAGTGAAAGTTT IL2 Interleukin 2 NM_000586 266 220-485 ACTCACCAGGATGCTCACAT AGGTAATCCATCTGTTCAGA IL2 Interleukin 2 NM_000586 207 55-261 AATGTACAGGATGCAACTCC TTCTTGGGCATGTAAAACTT IL32 interleukin 32 NM_001012631 205 190-394 ATTTGTGCCAGGAAGACTGC ACCTGTCCACGTCCTGATTC IL32 interleukin 32 NM_001012631 234 577-810 CTGGGGAGAGCTTTTGTGAC GTGTCAGCTCCTCCTTGTCC IL32 interleukin 32 NM_001012631 207 412-618 AGCTGGAGGACGACTTCAAA CCTGGAACCATCTCATGACC IL6 interleukin 6 NM_000600 167 CAGACAGCCACTCACCTCTT CTTTTTCAGCCATCTTTGGA IL6 interleukin 6 NM_000600 230 TGCAGAAAAAGGCAAAGAAT CTGACCAGAAGAAGGAATGC IL6 interleukin 6 NM_000600 180 AGGAGACTTGCCTGGTGAAA CAGGGGTGGTTATTGCATCT IL6 interleukin 6 NM_000600 167 549-715 ATGCAATAACCACCCCTGAC GAGGTGCCCATGCTACATTT IL8RA-4 Interleukin 8 receptor, alpha NM_000634 224 582-805 TTTGTTTGTCTTGGCTGCTG AGTGTACGCAGGGTGAATCC IL8RA-5 Interleukin 8 receptor, alpha NM_000634 243 1647-1889 GGTGTGTTGCAGTGTCTGCT TAAGGGCTGCTTGTCTCGTT IL8RA-6 Interleukin 8 receptor, alpha NM_000634 198 848-1045 CATCTTTGCTGTCGTCCTCA CCGATGAAGGCGTAGATGAT IL8RB-2 Interleukin 8 receptor, beta NM_001557 193 1924-2116 ACAGCTACTTGGGAGGCTGA TGCAGTGGTCACACCATTTT IL8RB-3 Interleukin 8 receptor, beta NM_001557 180 1004-1183 ACATGGGCAACAATACAGCA TGAGGACGACAGCAAAGATG IL8RB-4 Interleukin 8 receptor, beta NM_001557 219 140-358 CCCAGGACAGACCTCATTGT GGACACCTCCAGAAGAGCAG IL8RB-5 Interleukin 8 receptor, beta NM_001557 230 1098-1327 CTACGGATTCACCCTGCGTA TGTGAAGGATGCCCAGAATC IL8RB-6 Interleukin 8 receptor, beta NM_001557 208 910-1117 AGCATCTGGGGTCTGTCCTT TACGCAGGGTGAATCCGTAG IL8RB-7 Interleukin 8 receptor, beta NM_001557 165 604-765 AACTCCCTCGTGATGCTGGT GCACAGGAATGTGCCAAAAA IMP IMP (inosine monophosphate) dehydrogenase 1 NM_000883 192 1098-1289 GGATGACAAATACCGTCTGG ACACCAGCATCAATCAGGTT INHBA inhibin, beta A NM_002192 256 22-277 GTGCCAATACCATGAAGAGG CAGAAATCCTCTCAGCCAAA INHBA inhibin, beta A NM_002192 220 453-672 AGAAGAGACCCGATGTCACC TTGGAAATCTCGAAGTGCAG INS-3 insulin NM_000207 244 130-373 CCTTTGTGAACCAACACCTG AGCTGGTAGAGGGAGCAGAT INS-4 insulin NM_000207 169 24-192 AGAAGAGGCCATCAAGCAGA CCCCGCACACTAGGTAGAGA INS-5 insulin NM_000207 183 191-373 GGAACGAGGCTTCTTCTACA AGCTGGTAGAGGGAGCAGAT INS-6 insulin NM_000207 201 23-223 CAGAAGAGGCCATCAAGCAG CGGGTCTTGGGTGTGTAGAA INS-7 insulin NM_000207 210 155-364 CTCACACCTGGTGGAAGCTC AGGGAGCAGATGCTGGTACA IRF4-1 interferon regulatory factor 4 NM_002460 249 1168-1417 ACCTGCAAGCTCTTTGACAC TGGATTGCTGATGTGTTCTG IRF4-2 interferon regulatory factor 4 NM_002460 199 422-620 ACTTTGAGGAACTGGTTGAGC GGCATCATGTAGTTGTGAACC IRF4-3 interferon regulatory factor 4 NM_002460 243 4254-4496 GTCCTGAGCGAAAACAGGAG ACCCAAGACTCCCACAGTTG IRF4-4 interferon regulatory factor 4 NM_002460 242 2669-2910 GGAGCTGACTACGGAACTGC GTATGAGAAACGGCCTGGAG IRF4-5 interferon regulatory factor 4 NM_002460 289 3702-3991 TTAATTCTCCAAGCGGATGC AAGGAATGAGGAAGCCGTTC IRF4-6 interferon regulatory factor 4 NM_002460 224 3219-3443 TTTCCCAGCCCAAATTCTC TACTGGGTACATGGCAGTGG IRS1 insulin receptor substrate 1 NM_005544 229 1250-1478 ACTCCAAGAACAAGCACCTG TCACCGTAGCTCAAGTCCTC IRS1 insulin receptor substrate 1 NM_005544 231 2255-2485 CTAGTGCTTCGGTGTCTGGT CACCCCGAGACAAAATGTAG IRS1 insulin receptor substrate 1 NM_005544 150 4560-4709 AGACCTGGATTTGGTCAAGG GCATAGGCGCTTAAATCCTC IRS2 insulin receptor substrate 2 NM_003749 176 5651-5826 TCCAGCCCCTATGTTATTGA CGGTCAAGTTCAGCAGTTTT IRS2 insulin receptor substrate 2 NM_003749 157 4481-4637 ATTGACTTCTTGTCCCACCA TCCAAAAGAAAACTGCAAGC IRS2 insulin receptor substrate 2 NM_003749 247 6113-6359 GCAAAAGTCTTCCTGCTTCC ACCACCCATTGATGCCTATT IRX4 iroquois homeobox protein 4 NM_016358 189 GCCAGATACCCTGAAGCATA GGAGTCGAGTGTGCAAGAGT IRX4 iroquois homeobox protein 4 NM_016358 219 ATGACCCTCACACAGGTCTC CTCCAGCTCCTTCTCCTCTT IRX4 iroquois homeobox protein 4 NM_016358 241 ACCAAGATGACCCTCACACAG CGTCCAAGTCACTAAGCTCCA IRX4 iroquois homeobox protein 4 NM_016358 143 1811-1955 AACTTGGACTCCTGGGAACAT TCAGGGTATCTGGCCTCTTCT ISG20 interferon stimulated exonuclease gene 20kDa NM_002201 191 709-899 ACAAGAGCATCCAGAACAGC TAGTTGCTGTCCCAAAAAGC ISG20 interferon stimulated exonuclease gene 20kDa NM_002201 206 398-603 TGCTGTGCTGTACGACAAGT CGCTCATGTCCTCTTTCAGT ISL1 ISL1 transcription factor, LIM/homeodomain, (islet-1) NM_002202 318 2156-2473 CTCTTGGCCTGTCCTGTAGC GCAATGCAAGAGCAAACAAA ISL1 ISL1 transcription factor, LIM/homeodomain, (islet-1) NM_002202 178 1520-1697 TGGCAGTGAAGTAGCATCAA TTTTCATTGACTGGGTCGTT ISL1 ISL1 transcription factor, LIM/homeodomain, (islet-1) NM_002202 ISL2 ISL2 transcription factor, LIM/homeodomain NM_145805 242 GCCCTCTCCTCTCCTCTCTA TTCAAGGCAAGTCTGGTTTC ISL2 ISL2 transcription factor, LIM/homeodomain NM_145805 215 1033-1247 CAACAGCTGGTCTCCTTCTC AGAGCTTTCGGAACTGGAAT ISL2 ISL2 transcription factor, LIM/homeodomain NM_145805 219 TCCTTTTCTGGGTGCTATGG TAGTCCCGCTTGCAGTAGGT ITCH itchy E3 ubiquitin protein ligase homolog NM_031483 174 2458-2631 GCCATCTACCGTCATTATGC GAATTTCTGTGGTCCATTGC ITCH itchy E3 ubiquitin protein ligase homolog NM_031483 188 867-1054 ACCAGCATCTGTCAATGGTT GCAAGGGAGCTTGAGTTACA ITCH itchy E3 ubiquitin protein ligase homolog NM_031483 216 1473-1688 CCCCAGAAGTCAAGGTCAAT TGACACCAGAACCGGAAATA ITCH itchy E3 ubiquitin protein ligase homolog NM_031483 247 3382-3628 TCAGGGAAAAGTTGGTCACA ACAGGGTCTCCCTATGTTGC ITGA10 integrin, alpha 10 NM_003637 184 4337-4520 TGATTTTCTGAAGCCAGGAG AAAGCATTTCCCATCATCAA ITGA10 integrin, alpha 10 NM_003637 248 1823-2070 CTGTACCATGGAACCCAGAG TCCCTCTGAACCACACTGAT ITGA10 integrin, alpha 10 NM_003637 168 760-927 GGTGAGAGCAGCAAAGAACC TCCTCTCCATCATGGGACTC ITGA11 integrin, alpha 11 NM_001004439 166 1746-1911 CCAGGATTCCTACAATGACG GATGCTGCAGCCAAAATACT ITGA11 integrin, alpha 11 NM_001004439 220 3689-3908 GGACACCAGTCCAGGTAGTG TGTGTAGGGGTGTCCCTTTA ITGA11 integrin, alpha 11 NM_001004439 228 2982-3209 GAGCCACTACGAGGTCAAGC GTGCTATTGCCCCAGATGTT ITGA11 integrin, alpha 11 NM_001004439 204 3850-4053 GGGAGACTGGGACACCTTTA TGTGCAGATTGGGTTCGTAT ITGA11 integrin, alpha 11 NM_001004439 228 4145-4372 AAGTCACACCCACTCCCTTC ATGTGTGAGTTGCGGTCAAT ITGA11 integrin, alpha 11 NM_001004439 104 1808-1911 TCTACATCTTCCACGGCTTC GATGCTGCAGCCAAAATACT ITGA2B integrin, alpha 2b NM_000419 203 604-806 TTAGCTGGGACAAGCGTTAC GTTGCTGGAGTCAAAGGAGA ITGA2B integrin, alpha 2b NM_000419 219 787-1005 TCTCCTTTGACTCCAGCAAC CCACTGAATGCCCAAAATAC ITGA2B integrin, alpha 2b NM_000419 196 2288-2483 GCAGATACGGAGCAAGAACA GAGCTCATAGGTGTGCTCCA ITGA2B integrin, alpha 2b NM_000419 279 2620-2898 TCAACCCTCTCAAGGTGGAC GCAGCACAAACTGATCCAGA ITGA2B integrin, alpha 2b NM_000419 166 346-511 ATGAGACCCGAAATGTAGGC CTACCTACGGGCGTCTTCTC ITGA2B integrin, alpha 2b NM_000419 146 3119-3264 ACCCCTGGAAGAAGATGATG AAGAGGACCCAATGGAACAG ITGA4-10 Integrin, alpha 4 NM_000885 185 3588-3772 GTTTTCCAGAGCCAAATCCA GCCAGCCTTCCACATAACAT ITGA4-11 Integrin, alpha 4 NM_000885 190 2339-2528 AAGGCAGAGTCTCCACCAAG TGATGACATGAGGACCAAGG ITGA4-4 Integrin, alpha 4 NM_000885 295 1541-1835 TTTCGGAGCCAGCATACTAC GGTTTGTTTCCATTGCATTC ITGA4-5 Integrin, alpha 4 NM_000885 293 2407-2699 ACAGGTGTCCAGCAGAGAAG TATTTTCATGGGGCTTCAAA ITGA4-6 Integrin, alpha 4 NM_000885 126 2119-2244 TTTTCGGTCTGATTCTGCTG ACAGAAGGCCATCCATTTTC ITGA4-7 Integrin, alpha 4 NM_000885 244 3364-3607 GAGTGCAATGCAGACCTTGA TGGATTTGGCTCTGGAAAAC ITGA4-8 Integrin, alpha 4 NM_000885 176 1091-1266 AATGGAGAACCTTGTGGAAA ACTCCATAGCAACCACCAGT ITGA4-9 Integrin, alpha 4 NM_000885 193 5180-5372 TAAGAGAGCTGTGGCCGAAT GCCTTCGCAAATCTCAGAAC ITGA6 integrin, alpha 6 NM_001079818 159 1378-1536 ACCCAGATATTGCAGTTGGA TTCGATCAAGGTCCATGTTT ITGA9 integrin, alpha 9 NM_002207 177 2840-3016 GGACAGTTCGTCTGTCATCC AACAAACTGATGGCGATGAT ITGA9 integrin, alpha 9 NM_002207 153 1668-1820 ATGGGTCAGGTCACAGAGAA CTCCTCTCCAGTCACATGCT ITGA9 integrin, alpha 9 NM_002207 155 1042-1196 AGATCAGGGATGAGGGACAG ATCTGGGAACCCATCATTGT ITGAD integrin, alpha D NM_005353 242 2120-2361 GAAACCAAGAACCCCACTTT TCTTGCCCACAGTTCTTCTC ITGAD integrin, alpha D NM_005353 238 2385-2622 GTGTCACCCTCAGCTTCTCA CTGCTTCTTAGGCCCTCATC ITGAD integrin, alpha D NM_005353 216 1182-1397 CCTTCCTGTATCCCCCAAAT CTGTGACTTCGGCCTTCTTC ITGAD integrin, alpha D NM_005353 179 1023-1201 AGAAGCAGCTGCAGGAGAAG ATTTGGGGGATACAGGAAGG ITGAD integrin, alpha D NM_005353 211 1832-2042 CAGGATGGACTGATGGACCT GCTGGTCCAGTGAGCTTTTC ITGAD integrin, alpha D NM_005353 217 2122-2338 AACCAAGAACCCCACTTTGA GGGGAGAGAAGCAGTGAAGA ITGAE integrin, alpha E NM_002208 186 1305-1490 ACAGATTGGCTTCAGTGCTC GCGTAACCCAGGTAGCTGTA ITGAE integrin, alpha E NM_002208 178 1564-1741 GTGTTTGAGCTCCAGAAGGA CTCTGCCTTCTTCTCCATGA ITGAE integrin, alpha E NM_002208 212 317-528 TCCAGGATGAAATCCTTTGC GTCGAAGAAGTTGGCCTGAG ITGAE integrin, alpha E NM_002208 118 3399-3516 TGAGGGACTGAATGCAGAGA CAACACCAGAAGTCCACCAA ITGAE integrin, alpha E NM_002208 281 2380-2662 CTTTGTGAGGACCTCCTGCT AGGGTCAGCTCCTTTGTGAG ITGAE integrin, alpha E NM_002208 131 809-939 TTGAGTGCAACTTTGCCTTG CTTGGTGACACTCCCCACTT ITGB1-2 integrin, beta 1 NM_002211 153 956-1108 GGATTCTCCAGAAGGTGGTT GGTAAAACAATGCCACCAAG ITGB1-3 integrin, beta 1 NM_002211 207 1444-1650 CAGGGGAAAATGGAAGAAAA ACTTGGGACTTTCAGGGATG ITGB1-4 integrin, beta 1 NM_002211 198 2198-2397 CACATGCACACAGGAATGTT CAGTGGGACACTCTGGATTC ITGB1BP3 integrin beta 1 binding protein 3 NM_170678 204 417-620 CAAATAGCAGTTGGGGAAGA CAGGGGCTTGTAGCTGTAGA ITGB1BP3 integrin beta 1 binding protein 3 NM_170678 186 12-197 CTCGTTGGAAAACGAAGCTC AGAAAACCTGGCGCCTTTAT ITGB1BP3 integrin beta 1 binding protein 3 NM_170678 178 651-828 ACCGTCCCGTATGAAGAGTG AGAGCTCCTCTCGGGACTTC ITGB3 Integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) (ITGB3) NM_000212 250 AATGAGGAAGTGAAGAAGCA TGGTAGTGGAGGCAGAGTAA ITGB3 Integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) (ITGB3) NM_000212 247 ATGTGTGTGTGTTGTGTGTG CTTGGTGTCCCTTCCTCT ITGB3 Integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) (ITGB3) NM_000212 184 GTGACCTGAAGGAGAATCTGC TTCTTCGAATCATCTGGCC ITGB3 Integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) (ITGB3) NM_000212 156 GGGGTAGGTTGGGAGAATGT TCTGGGACAAAGGCTAAGGA ITGB3 Integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) (ITGB3) NM_000212 150 TCCCTCATCCATAGCACCTC TCCATCCTGGCACTTATTCC ITGB3 Integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) (ITGB3) NM_000212 160 2233-2392 TGCTCATCTGGAAACTCCTC TATCATTAAGTGCCCCGGTA ITGB3 Integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) (ITGB3) NM_000212 161 3012-3172 GCTATGGTTCTCTCGCAAGG AGAGCTGCCAATAAGGCAAA ITGB3 Integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) (ITGB3) NM_000212 244 1451-1694 CAATGGGACCTTTGAGTGTG CTTGTAGCGGACACAGGAGA ITGB6 integrin, beta 6 NM_000888 188 1843-2030 CTCAGGACCAACCTGTGAAC GAGAGCAGGAAACAGAACCA ITGB6 integrin, beta 6 NM_000888 220 1402-1621 GAACAGCTCCAAATGTCACC AGGCCCATAAATGTTTCCAT ITGB6 integrin, beta 6 NM_000888 192 GATTGAACTGCTTTGCCTGT AAAAGGTTTGCTGGGGTATC ITGB8 integrin, beta 8 NM_002214 228 2372-2599 ACCATGGAAATCTGTGTGCT TATAACAGGTGGGGCAGTGT ITGB8 integrin, beta 8 NM_002214 209 2732-2940 GTTTCTCCAGCCCAAGCTAC TCGGTAGGTGACTGCTCTTG ITGB8 integrin, beta 8 NM_002214 168 4851-5018 TGGAGTTCTCCAGTGCTCAG TTGTTGTCATGGGCAAAACT ITGB8 integrin, beta 8 NM_002214 231 1670-1900 ACCCCTCACTAGGCCAACTT TGCCTTGTACCTGGTTTTCC ITGB8 integrin, beta 8 NM_002214 287 7107-7393 GCAACTGTTGGCACTTCAGA GCTGAAATCATTCGCACTCA ITGB8 integrin, beta 8 NM_002214 203 4084-4286 TTCCCAGAATCACTCCAACC GCAGGAGAACTGCTTGAACC KCNE1 potassium voltage-gated channel, Isk-related family NM_000219 170 3087-3256 TTGCAGAGAGAGACCCAGAG CTGGGAAGACTAACGCCATA KCNE1 potassium voltage-gated channel, Isk-related family NM_000219 171 1534-1704 CAGGCCAGATTTACAGGAGA GCAGAATCAGTGTGTGCTTG KCNE2 potassium voltage-gated channel, Isk-related family, member 2 NM_172201 226 523-750 AGGCACCAAGCTAACATCTG CCCGGAAAGTAAAAGAGGTC KCNE2 potassium voltage-gated channel, Isk-related family, member 2 NM_172201 218 298-515 TCATGGTGATGATTGGAATG TTATCAGGGGGACATTTTGA KCNH2 potassium voltage-gated channel, subfamily H, member 2 NM_000238 191 2430-2620 GGGAGCCTCTGAACCTGTAT CGGGATCATGTTGGTATCTC KCNH2 potassium voltage-gated channel, subfamily H, member 2 NM_000238 160 TCTACACGGCTGTCTTCACA CGGAAGTTGATGAGGATGTC KCNH6 potassium voltage-gated channel, subfamily H, member 6 NM_030779 166 457-622 TTCTCAACTTCGAGGACCTG ATCTGGCTGATGGTCCTGTA KCNH6 potassium voltage-gated channel, subfamily H, member 6 NM_030779 192 1725-1916 CTGGAGGAGTATTTCCAGCA GGTCTTGAACTTGACGGCTA KCNH6 potassium voltage-gated channel, subfamily H, member 6 NM_030779 240 892-1131 CTGTCTTCACGCCCTACTCA CCATGTCAATGAGGAACCAG KCNH6 potassium voltage-gated channel, subfamily H, member 6 NM_030779 217 2658-2874 GCCAGCTACATTCTGGAAGC ATGGTGCCAGAGTTTTGTCC KCNJ2 potassium inwardly-rectifying channel, subfamily J, member 2 NM_000891 171 4441-4612 TTGTCAAGAGCCAAGACACA AGCAACACACATCTGGGAAT KCNJ2 potassium inwardly-rectifying channel, subfamily J, member 2 NM_000891 230 TTTGCACAGTGGAGCTTACA GTGCCCCTTTCTTCTTCTTC KCNRG potassium channel regulator NM_173605 247 541-787 TACCTGCTACAGCCAAGACC CAGAACCACACTGGAAAACC KCNRG potassium channel regulator NM_173605 186 1341-1526 CTAGCTTGGGTGACAGAGGA AAGTGGGAAAATACGGAAGG KCNRG potassium channel regulator NM_173605 215 61-275 GCAAACACAGCCATGGATAC CCCACATTCAAAGTGACCAG KCNRG potassium channel regulator NM_173605 222 773-994 TCCAGTGTGGTTCTGACAGC TGAGCACTTCAGGGCTTTTT KIAA1199 KIAA1199 NM_018689 268 4667-4934 GCTGACAGCAAAGATCCACT GCCACTCAAAGTCTCCTGAA KIAA1199 KIAA1199 NM_018689 190 3710-3899 GTTTGCTTTCTGCTCCATGA CACCTCCAAGAAATGGTCCT KIAA1199 KIAA1199 NM_018689 284 5999-6282 TCTCCTGTCTCTGCAGCTCT GCAGGAAAGGGGATAAATGT KIT-3 V-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog NM_000222 172 270-441 GGGCTTTGTCAAATGGACTT GAAAAGCTTGGCAGGATCTC KIT-4 V-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog NM_000222 206 1641-1846 CCACACCCTGTTCACTCCTT TTCTGGGAAACTCCCATTTG KIT-5 V-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog NM_000222 246 495-740 TCCTCTCACAGACCCAGAAG TTGGACACAGACACAACAGG KLF10 Kruppel-like factor 10 NM_005655 157 1521-1677 AGCTACCAAACTGGCAGATG CTTGCAGTGGAAGCATTTTT KLF3 Kruppel-like factor 3 NM_016531 230 1349-1578 GAAACGCCACATGCTAGTCT TTTAGGTCTGACCCGTGGTA KLF3 Kruppel-like factor 3 NM_016531 202 1150-1351 AAAGCTCCCACTTGAAAGCA TTCCTATGGAGGGCAAGATG KLF3 Kruppel-like factor 3 NM_016531 186 5383-5569 CTGCAGACAATCCAGCAAAA CCACTCCCCAACATGAGAGT KLF4 Kruppel-like factor 4 NM_004235 171 77-247 CGCCTTGCTGATTGTCTATT CCCAAAGTCAACGAAGAGAA KLF4 Kruppel-like factor 4 NM_004235 238 1633-1870 CCAGGCACTACCGTAAACAC AGTTGGGAACTTGACCATGA KLF4 Kruppel-like factor 4 NM_004235 189 1558-1726 CCCACACAGGTGAGAAACCT ATGTGTAAGGCGAGGTGGTC KLF4 Kruppel-like factor 4 NM_004235 127 366-492 ACTCGCCTTGCTGATTGTCT AATTGGCCGAGATCCTTCTT KLF4 Kruppel-like factor 4 NM_004235 260 2049-2308 ATATGACCCACACTGCCAGA CCCCTTGGCATTTTGTAAGT KLF4 Kruppel-like factor 4 NM_004235 238 1925-2162 CCAGGCACTACCGTAAACAC AGTTGGGAACTTGACCATGA KLF9 Kruppel-like factor 9 NM_001206 202 4642-4843 ATGAAAATCCAAATGCAGGA GGTGAAGGGCTTTCTTCTTC KLF9 Kruppel-like factor 9 NM_001206 193 607-799 GGCAGGGGGAGAAAGTAAAC GCGCCAGGTCTAAGAGACAC KLF9 Kruppel-like factor 9 NM_001206 165 2239-2403 CCCTTGAAGAGGCAACTCTC TACCCCAGTCTTGGCCTTAC KLK2 kallikrein-related peptidase 2 NM_005551 213 1639-1851 CTGGCAGGAAGTCAAACCTA GTGAGCTTCCTCAGTTGGAA KLK2 kallikrein-related peptidase 2 NM_005551 212 2048-2259 AGGCCCCAAGTATATCAAGG CCTGATCACAAGACCAAACC KLK2 kallikrein-related peptidase 2 NM_005551 250 1375-1624 GAGGGACTAGGGGGAGAAAC AAAGCCAAGTTGCCAGTCTT KLK3 kallikrein-related peptidase 3 NM_001648 215 1012-1226 CTGTGTCCTGGGGAATACTG CTTGCTGTGAGTGTCTGGTG KLK3 kallikrein-related peptidase 3 NM_001648 191 344-534 CGATATGAGCCTCCTGAAGA ACTCCTCTGGTTCAATGCTG KLK3 kallikrein-related peptidase 3 NM_001648 214 53-266 GGTTGTCTTCCTCACCCTGT CAGCAAGATCACGCTTTTGT KLK3 kallikrein-related peptidase 3 NM_001648 204 1209-1412 CCAGACACTCACAGCAAGGA CTGAGGGTTGTCTGGAGGAC KLK3 kallikrein-related peptidase 3 NM_001648 cagtctgcggcggtgtt gcaagatcacgcttttgttcct KLK6 kallikrein-related peptidase 6 NM_002774 175 1115-1289 GTCCTGATTCTCCCTGGTTT CCTCTGCAGGAAGAAATCAA KLRC1 killer cell lectin-like receptor subfamily C, member 1 NM_002259 164 81-244 GAGACTAACCTGGCCTCTCC TTGCCTTTAGGTTTTCGTTG KLRC1 killer cell lectin-like receptor subfamily C, member 1 NM_002259 155 1138-1292 AACAGTCAAACCCATGGAGA TCGCAGAGTTACAACCATCA KLRC2 killer cell lectin-like receptor subfamily C, member 2 NM_002260 155 973-1127 AACAGTCAAACCCATGGAGA TCGCAGAGTTACAACCATCA KLRC2 killer cell lectin-like receptor subfamily C, member 2 NM_002260 168 501-668 CCAGCATTTTACCTTCCTCA ATCCACACTGGGCTGATTTA KLRK1 killer cell lectin-like receptor subfamily K, member 1 NM_007360 158 579-736 AGCAAAGAGGACCAGGATTT AGTGCACAGTCTCCCTTCTG KLRK1 killer cell lectin-like receptor subfamily K, member 1 NM_007360 198 263-460 ATGGCAAAAGCAAAGATGTC CATGGGCCACAGTAACTTTC KLRK1 killer cell lectin-like receptor subfamily K, member 1 NM_007360 213 943-1155 AGACTCCACAGGACCAAACC CTGGCCTTCTCTTCCTTCAC KLRK1 killer cell lectin-like receptor subfamily K, member 1 NM_007360 154 195-348 CACAGCTGGGAGATGAGTGA CTACAGCGATGAAGCAGCAG KRT81 keratin 81 NM_002281 163 372-534 GAGCAGATCAAGTCCCTCAA GAGTCTCGATGTAGCCCTCA KRT81 keratin 81 NM_002281 171 511-681 TGTTTGAGGGCTACATCGAG GAGCCACAAACTCGTTCTCA KRTAP5-8 keratin associated protein 5-8 NM_021046 209 805-1013 ATCCCCTCTTCCTTTCCTGA AAAAACAATCGGAGCTGTGG KRTAP5-8 keratin associated protein 5-8 NM_021046 150 963-1112 TCCACCCTTCATCTTCATCC CAAGGCCAGGTCAGAGGTAG KRTAP5-8 keratin associated protein 5-8 NM_021046 160 593-752 TGAGGCTCTGCCTACAAATC AGAGGCTGAGCAGCTGAGTA KRTAP5-8 keratin associated protein 5-8 NM_021046 155 838-992 ACCTTCTCAGGGCTTCAAGA AGCTCAGGCAGGATGAAGAT KRTAP5-9 keratin associated protein 5-9 NM_005553 212 723-934 CTGTGTGCTACCAGTGCAAG CCTGGGTCTTGGGATATTCT KRTAP5-9 keratin associated protein 5-9 NM_005553 187 28-214 GGAAGGGCTCATACTTGGAT CAGGTAGAGGAGCAGGTGAG KRTAP5-9 keratin associated protein 5-9 NM_005553 157 898-1054 CCTGCCCATTCCCTATAAGA TGCTGTCTCCCATGGAATTA KRTAP5-9 keratin associated protein 5-9 NM_005553 153 872-1024 CCCTGAGGAAATGGAATGAA GAATTCCAGGCTCTTGCTTG KYNU kynureninase (L-kynurenine hydrolase) NM_003937 208 692-899 CGGATGATAAAGCCAAGAGA TTCCAACTGCATGTGCTAGA KYNU kynureninase (L-kynurenine hydrolase) NM_003937 167 859-1025 GGGTTGTTATGTTGGCTTTG TAATCGTATGGGCATGCTTT LAMP1 lysosomal-associated membrane protein 1 NM_005561 195 1402-1596 AGTGTCTGCTGGACGAGAAC GACCCTAAGCCCAGAGAAAG LAMP2 lysosomal-associated membrane protein 2 NM_002294 172 224-395 TTCTGGTCTGCCTAGTCCTG ACAGTGCCATGGTCTGAAAT LAMP3 lysosomal-associated membrane protein 3 NM_014398 236 1343-1578 GGATGAGTGCTCGTCTGACT TTGTTTGAAGGACCCACACT LAPTM5 lysosomal associated multispanning membrane protein 5 NM_006762 225 1687-1911 CATCAACAATCCAATGCTCA ACGAACAGATGTGCCTGATT LAPTM5 lysosomal associated multispanning membrane protein 5 NM_006762 216 538-753 TACATGGAAGTGCCCACCTA TCTCTTCTCCTCCACCGAGT LCAT lecithin-cholesterol acyltransferase NM_000229 239 459-697 CAGAACCTGGTCAACAATGG CCATCAATAAAGCGGTCCTT LCAT lecithin-cholesterol acyltransferase NM_000229 176 542-717 GGAGGAGTACTACCGCAAGC GAGCCCCAAGAGAGATGAAG LCAT lecithin-cholesterol acyltransferase NM_000229 214 218-431 GGTGAACTGGATGTGCTACC CTTGCTGCTGTCCAGGTACT LCE3D late cornified envelope 3D NM_032563 113 347-459 gatgctgagacaagcgattt ctagctcagcctgtgaaagc LCE3E late cornified envelope 3E NM_178435 252 23-274 ctctctgcacctggacatct ctgtcacaggagttggacct LCK lymphocyte-specific protein tyrosine kinase NM_005356 212 1335-1546 GGCCAAGTTTCCCATTAAGT ACAGCTCCTCTGGACAGTTG LCK lymphocyte-specific protein tyrosine kinase NM_005356 250 51-300 GAAGGGAGCTGAGACTGTCC GGAGCCTTCGTAGGTAACCA LCK lymphocyte-specific protein tyrosine kinase NM_005356 243 1712-1954 CTGACTTGGGGAGATGGAGT CTTCTCCCCTCTCTCTGTGG LCK lymphocyte-specific protein tyrosine kinase NM_005356 216 1453-1668 ATCCCTTACCCAGGGATGAC TCAAGGCTGAGGCTGGTACT LCK lymphocyte-specific protein tyrosine kinase NM_001042771 212 1318-1529 GGCCAAGTTTCCCATTAAGT ACAGCTCCTCTGGACAGTTG LCN2 lipocalin 2 NM_005564 233 323-555 TACAATGTCACCTCCGTCCT GTTCTCCCGTAGAGGGTGAT LDHA lactate dehydrogenase A NM_005566 153 AGGCTACACATCCTGGGCTA CCCAAAATGCAAGGAACACT LDHA lactate dehydrogenase A NM_005566 248 AGCAGGTGGTTGAGAGTGCT GGCCTCTTCCTCAGAAGTCA LDHA lactate dehydrogenase A NM_005566 177 GGCCTGTGCCATCAGTATCT ACCAGCTTGGAGTTTGCAGT LETM1 leucine zipper-EF-hand containing transmembrane protein 1 NM_012318 166 2228-2393 GGGAGAACGTCATCAGTGTC TCTTCTTTGTCCACCAGCTC LETM2 leucine zipper-EF-hand containing transmembrane protein 2 NM_144652 236 1156-1391 GAGAACATGGTGGATCTTGC GAGAGTGAGCTCCATCCTCA LGALS1 galectin 1 NM_003005 150 194-343 CTGAACCTGGGCAAAGACAG AGGCTGGAAGGGAAAGACAG LGALS1-2 246 AGCGGGAGGCTGTCTTTC TTTTCAGAGGGAGCAGAGG LGALS4? galectin 4 NM_002305 ? TTTGATCTGTCCATTCGCTG CCTGGATTTCCAATGTGTCC LGI1 leucine-rich, glioma inactivated 1 NM_005097 201 1440-1640 CTCCCATCAATCCTTACACG ACTGCGTACACATCCTCCAT LGI1 leucine-rich, glioma inactivated 1 NM_005097 205 761-965 TTCACTTGAGCCTTGCAAAC TTGCGCTTCTTGTATTCTGG LGI1 leucine-rich, glioma inactivated 1 NM_005097 248 1661-1908 GGGACGTGTACATTTGCTTG TGATCTTGGTGCCTGAACAT LIAS lipoic acid synthetase NM_006859 205 1355-1559 CAGCACTTTAGGAGGCCAAG ATCTTGGCTCACTGCAACCT LIAS lipoic acid synthetase NM_006859 201 394-594 GGAAGCTCGATGTCCCAATA TAATCCAGACCCCATTCTGC LIAS lipoic acid synthetase NM_006859 204 268-471 CCTAAAACGCCAGAAAGGAG ATCAACATGATCGTGGCTGT LIG3 ligase III, DNA, ATP-dependent NM_013975 193 491-683 CAGAGTCTGGGGGTGATATG GGTGTACCTGCTGCCTTAGA LIG4 ligase IV, DNA, ATP-dependent NM_002312 216 110-325 CTGGAACTGTATTGCCTGCT CTGCAAAAGGAACGTGAGAT LIN28 lin-28 homolog NM_024674 153 2513-2665 CCAGGCAAAAAGATCTGAAA AGAAAAGAGGGCAGGGTAGA LOC652493 similar to Ig kappa chain V-I region HK102 XM_941953 159 159-317 CAGTCAGGGCATTAGCAGTT AGGCTGCTGATTGTGAGAGT LOC652493 similar to Ig kappa chain V-I region HK102 XM_941953 205 91-295 CAGTTGACCCAGTCTCCATC ATTCTGTCCCAGATCCACTG LOC652493 similar to Ig kappa chain V-I region HK102 XM_941953 232 10-241 GGACACAGCATGGACATGAG TGGATGCAGCATAGATCAGG LRP1 low density lipoprotein-related protein 1 NM_002332 220 8362-8581 CGCCTCAGATGAGATGAACT ACTAGGGCAGGCGAAGTAAT LRP1 low density lipoprotein-related protein 1 NM_002332 217 7367-7583 AGCTACACGACATCCACCAT CGATAAGGGTCAGGACATTG LRP1 low density lipoprotein-related protein 1 NM_002332 159 12578-12736 ACACTGGTGCAGGACAACAT ACTTAGGCCTCGTTTGCTGT LTB-2 Lymphotoxin beta (TNF superfamily, member 3) NM_002341 157 80-236 AGGAGCCACTTCTCTGGTGA CTCTGGCAGCTTCTGAAACC LTB-3 Lymphotoxin beta (TNF superfamily, member 3) NM_002341 214 673-886 ACATCAGTCACCCCGATATG CAGCACTGAAGCTTTCCATT LTB-4 Lymphotoxin beta (TNF superfamily, member 3) NM_002341 194 239-432 GGAGCCAGAAACAGATCTCA GGTAGCCGACGAGACAGTAG LTB4R2 leukotriene B4 receptor 2 NM_019839 183 380-562 CTCAAGCTCTGCTTTGGAAG CCTCTTGGAAAAGTCAAGCA LTB4R2 leukotriene B4 receptor 2 NM_019839 221 514-734 CCCCCTCAAATCTCTTCATT TTTTCCATGTAAGGCATGGT LTB4R2 leukotriene B4 receptor 2 NM_019839 232 1034-1265 GGAATCTTACTGCCCCACTT GCTGAAAGGTTAAGCAGCAG LTB4R2 leukotriene B4 receptor 2 NM_019839 222 115-336 GATACGCTGTAGCCCACTCA GCTTGGGTACAGGTGATCCT LTB-5 Lymphotoxin beta (TNF superfamily, member 3) NM_002341 193 157-349 ATCAGGGAGGACTGGTAACG GTCAGAAACGCCTGTTCCTT LTB-6 Lymphotoxin beta (TNF superfamily, member 3) NM_002341 155 597-751 TACGGGCCTCTCTGGTACAC ATATTCCCTCACCCCACCAT LTB-7 Lymphotoxin beta (TNF superfamily, member 3) NM_002341 163 90-252 TCTCTGGTGACCTTGTTGCT CTGTTTCTGGCTCCTCCTCT MAGEA3-2 melanoma antigen family A, 3 NM_005362 152 465-616 GACTCCAGCAACCAAGAAGA AGCATTTCTGCCTTTGTGAC MAGEA3-3 melanoma antigen family A, 3 NM_005362 198 1300-1497 GTGGGTTTCTGTTCTGTTGG AATGGAATGGATTTCCCAAT MAGEA3-4 melanoma antigen family A, 3 NM_005362 213 868-1080 AAATCTGGGAGGAGCTGAGT CCATATGGTGCAGGACTTTC MAGED4 melanoma antigen family D, 4 NM_001098800 232 1234-1465 GAGGTCCCAGATACCCTCAA CAGGTGGATCCCAAACTTCT MAGED4 melanoma antigen family D, 4 NM_001098800 187 2084-2270 TGGGCCAGATACCATCAGTA GGATCCAGGAGAAGAAGCTG MAP1LC3A microtubule-associated protein 1 light chain 3 alpha NM_032514 172 442-613 GGACATCTACGAGCAGGAGA GGTAGAGGCAGCTCAGTTCA MAP1LC3A microtubule-associated protein 1 light chain 3 alpha NM_032514 202 514-715 CTTCTGAGCCAGCAGTAGGG GAGGGACAACCCTAACACGA MAP1LC3A microtubule-associated protein 1 light chain 3 alpha NM_032514 235 699-933 TGTTAGGGTTGTCCCTCTGG GGGACAATGACCACAGATCC MAP1LC3B microtubule-associated protein 1 light chain 3 beta NM_022818 158 1636-1793 GAATTCTCCCACACCAAGTG AAATAGTGAACCCCATGCAA MAP1LC3B2 microtubule-associated protein 1 light chain 3 beta 2 NM_001085481 202 246-447 TCCCGGTGATAATAGAACGA ACCTCTGAGATTGGTGTGGA MAP1LC3C microtubule-associated protein 1 light chain 3 gamma NM_001004343 223 129-351 GACAAGAGGAAGTTGCTGGA CTGACCAGGCTCTTGTTGTT MAP1LC3C microtubule-associated protein 1 light chain 3 gamma NM_001004343 175 808-982 TGATCTTGGCTCACTGCAAC CCTGAGGTCAGGAGTTCGAG MAP1LC3C microtubule-associated protein 1 light chain 3 gamma NM_001004343 221 681-901 TTTTGTGCTCCGTGTTCTTG TGGTGGCATGTGCTTGTAAT MAP1LC3C microtubule-associated protein 1 light chain 3 gamma NM_001004343 247 320-566 CGGAAGCCTTTTACTTGCTG CCAGCATCTGACACGTCTGT MAP1LC3C microtubule-associated protein 1 light chain 3 gamma NM_001004343 199 629-827 GGTGATCAGCTCCAACCAGT GTTGCAGTGAGCCAAGATCA MAP1LC3C microtubule-associated protein 1 light chain 3 gamma NM_001004343 193 833-1025 CCTCCTGGGTTCAAGTGATT GCCTGTAATCCCAGCACTTT MAP2 microtubule-associated protein 2 NM_002374 266 5026-5291 CCACTACCCCTGGGTCTACT GTCTGTTGATCCGATTTTGG MAP2K4 mitogen-activated protein kinase kinase 4 NM_003010 185 266-450 CAGGAGTTCAAAACCCACAC TATTTGCCCACTTGGTTTGT MAP3K8 mitogen-activated protein kinase kinase kinase 8 NM_005204 212 1831-2042 GCCGCAGACCTACTAAAACA CCGAGGTCGATGTAGAGAGA MAP3K8 mitogen-activated protein kinase kinase kinase 8 NM_005204 233 437-669 CCGCAGATGCAATCTTCTTA TGAGGTGGTCGTGAGGATTA MAP3K8 mitogen-activated protein kinase kinase kinase 8 NM_005204 206 931-1136 GGAACTGTGGAGGATTTGCT CCCCGAGGAATAAAATCAGA MAP3K8 mitogen-activated protein kinase kinase kinase 8 NM_005204 236 1068-1303 TTCCGATGTTCTCCTGATCC CAGTTTCACCCCACAGGACT MAPK14 mitogen-activated protein kinase 14 NM_001315 247 3275-3521 GTCAACTGGAGCAAGAAGGA ATGTGGTCACATGTGCAAAG MAPK14 mitogen-activated protein kinase 14 NM_001315 160 NYO GAGTAATCAGGCAGCCTTCA CTTCTGACTACTGGGGCAGA MAPK14 mitogen-activated protein kinase 14 NM_001315 WRONG! TCACACAGGGTTCCTGACAGA TGCAGCCTACAGACCAAATATCA MAPK14 mitogen-activated protein kinase 14 NM_001315 241 2299-2539 GCCCCAGTAGTCAGAAGCAG TAGGGGCTGAAGAGAGGTGA MAPK14 mitogen-activated protein kinase 14 NM_001315 107 1817-1923 CACTTTGGCTTCTCCTGTGA CAGGTCTGAAGCAACCAGAA MARCO macrophage receptor with collagenous structure NM_006770 156 184-339 CAAGCTGCTTTTCACCAAAT ATTCAGAACTTGGACCACCA MATN2 matrilin 2 (MATN2), transcript variant 1 NM_002380 228 839-1066 CCTTGAAGTCCATTGGGAGT TTCTGCAAGTCGTCTGATCC MATN2 matrilin 2 (MATN2), transcript variant 1 NM_002380 186 1503-1708 GCTACACTCTGGACCCCAAT GGTCACTCAGCAGGCAGTAA MCM2 minichromosome maintenance complex component 2 NM_004526 219 2665-2883 CGTCAGATCAACATCCACAA CCCTAGTACCCCGAGTTCAT MCM2 minichromosome maintenance complex component 2 NM_004526 171 1876-2046 CAGAGCATCTCCATCTCGAA CACCACACACAGGATGTCAA MCM2 minichromosome maintenance complex component 2 NM_004526 154 1278-1431 GCCAGGAGACGAGATAGAGC ATCGGTCAGTTCCCCTACAG MCM3 minichromosome maintenance complex component 3 NM_002388 193 467-659 CTTCCTCAGCTGTGTGGTCT GGGATTGTTCTCCTCATCCT MCM3 minichromosome maintenance complex component 3 NM_002388 187 2286-2472 GCAGACTCACAGGAGACCAA CAGCCTGGATCTCAACTGAA MCM3 minichromosome maintenance complex component 3 NM_002388 185 1843-2027 TCAAGCCTGTCCTGACACAG CAGGTCCACAGTCTTGCTCA MCM6 minichromosome maintenance complex component 6 NM_005915 168 471-638 GTTTGCTCACTCGCATCAGT TGTTGGCACAAACTGGATTT MCM6 minichromosome maintenance complex component 6 NM_005915 175 1009-1183 GGGGAAAGAGCTCAGAGATG CAGGACACCCCGTTTTACTT MCM6 minichromosome maintenance complex component 6 NM_005915 185 3392-3576 CAGTTCCTGTGTTGCAGCTT TTCTGGCTGCTCAAATTCAC MDFI MyoD family inhibitor NM_005586 206 442-647 CACTTCTGCCGAATGACTCT GTGGACACAGCAGTCTTCCT MDFI MyoD family inhibitor NM_005586 230 1076-1305 ACCCATGTCCTCTCAGAACC CCCTCCCCAAGTAACTTTCA MDFI MyoD family inhibitor NM_005586 MDFI MyoD family inhibitor NM_005586 MDM2 Mdm2 p53 binding protein homolog NM_002392 218 341-558 CACCTCACAGATTCCAGCTT CGCCAAACAAATCTCCTAGA MEF2C MADS box transcription enhancer factor 2, polypeptide C (myocyte enhancer factor 2C) NM_002397 167 TCCTAGAGACCGTACCACCA AAGGTCTGGTGAGTCCAATG MEPE matrix extracellular phosphoglycoprotein NM_020203 202 814-1015 GGCCAACCTTTTAAGGACAT CTTTCGCAGTTTCATCCCTA MGMT O-6-methylguanine-DNA methyltransferase NM_002412 155 398-552 TTTTCCAGCAAGAGTCGTTC GACAGGATTGCCTCTCATTG MGP matrix Gla protein NM_000900 249 303-551 AGCTCAATAGGGAAGCCTGT GTGCAGCCAGACAAGAGAAT MGP matrix Gla protein NM_000900 217 272-488 AGGATCCGAGAACGCTCTAA ATGCTGCTACAGGGGGATAC MGP matrix Gla protein NM_000900 224 163-386 TGAATCACATGAAAGCATGG AGCGATTATAGGCAGCATTG MLANA melan-A NM_005511 138 373-510 TCTCTGCAGAACAGTCACCA TCCTACACCATTCCAAAGGA MLANA melan-A NM_005511 214 779-992 GAACCTTGACCGACATGAAC GCGAAACTCCATCTCAAAAA MLANA melan-A NM_005511 112 1059-1170 CAAGCAATTCTCCTGCCTTA CTGACCAACATGGAGAAACC MLANA melan-A NM_005511 162 36-197 gtgccctgaccctacaagat acaataccaacagccgatga MLANA melan-A NM_005511 199 239-437 tcatgttggcactcaatgtg agcatgtctcaggtgtctcg MLANA melan-A NM_005511 184 1141-1324 gtagagacggggtttctcca gcattgagccttgaagtgaa MLXIPL MLX interacting protein-like, mRNA BC012925 223 CTCTGTCACCTCCACTTGCT CATCCACACACACACACACA MLXIPL MLX interacting protein-like, mRNA BC012925 205 CCTCAAGGTGAGCAAAGCTA GTCTCGCATCTGGTCAAAAC MLXIPL MLX interacting protein-like, mRNA BC012925 243 TATGTGAAGCGGAGGAAGAG GCGGGAGTTGGTAAAGAAAT MLXIPL MLX interacting protein-like, mRNA NM_032951 120 2969-3088 AACGGTGGAAAGAGGAGGAT AGGAGCAGAGAGAGGGAACC MLXIPL MLX interacting protein-like, mRNA BC012925 174 GGAAGTTCTGGGTGTTCAGC CTCTAGCAGGCAGGGAGATG MLXIPL MLX interacting protein-like, mRNA BC012925 114 ACTCACACGCCTCTTCGAGT TTCAGGCGGATCTTGTCTCT MMD2 monocyte to macrophage differentiation-associated 2 NM_198403 161 221-381 TTCCAGAAGACGAAATACGC TCGTCCGACAGGAAGTAGAG MMD2 monocyte to macrophage differentiation-associated 2 NM_198403 172 459-630 CCATCTCCTGGAAGAAGAGC ACGGAAGCCATAATCCAGAC MMD2 monocyte to macrophage differentiation-associated 2 NM_198403 176 379-554 CGATGACTGGGAGACCATCT CGTAGGAAGCCGCTATGAAG MMD2 monocyte to macrophage differentiation-associated 2 NM_198403 214 1423-1636 GTGACCATGGCAGACATCAC GGGGAGATGAGGAGATAGGC MMD2 monocyte to macrophage differentiation-associated 2 NM_198403 168 916-1083 GCAGACCAAGGTGTCCAAAT CTGGCTGTCACCAGAAGTCA MMP11-2 Matrix metallopeptidase 11 (stromelysin 3) NM_005940 151 ATGCTGATGGCTATGCCTAC AGCCATGGTCAGAGGAAAGT MMP13-3 Matrix metallopeptidase 13 (collagenase 3) NM_002427 224 221-444 ACTGAGAGGCTCCGAGAAAT TTGAATGCCTTTTCGACTTC MMP13-4 Matrix metallopeptidase 13 (collagenase 3) NM_002427 172 62-233 TTGAGCTGGACTCATTGTCG GGAGCCTCTCAGTCATGGAG MMP13-5 Matrix metallopeptidase 13 (collagenase 3) NM_002427 199 536-734 AAGGAGCATGGCGACTTCTA GGTCCTTGGAGTGGTCAAGA MMP2 Matrix metallopeptidase 2 (gelatinase A, 72kDagelatinase, 72kDa type IV collagenase) NM_004530 168 2091-2259 AGAAAATGGATCCTGGCTTC TTCCAAACTTCACGCTCTTC MMP2 Matrix metallopeptidase 2 (gelatinase A, 72kDagelatinase, 72kDa type IV collagenase) NM_004530 196 1565-1761 ATGGCACCCATTTACACCTA AGATCTCACCACGGATCTGA MMP2 Matrix metallopeptidase 2 (gelatinase A, 72kDagelatinase, 72kDa type IV collagenase) NM_004530 179 1208-1386 TATGACAGCTGCACCACTGA TCATATTTGTTGCCCAGGAA MMP2 Matrix metallopeptidase 2 (gelatinase A, 72kDagelatinase, 72kDa type IV collagenase) NM_004530 248 1700-1947 CCTGAGATCTGCAAACAGGA AGGGTGCTGGCTGAGTAGAT MMP2 Matrix metallopeptidase 2 (gelatinase A, 72kDagelatinase, 72kDa type IV collagenase) NM_004530 241 2906-3206 CTCCACTGGATGGAGGAAAA CTTTCCAGCAGACACCATCA MMP2 Matrix metallopeptidase 2 (gelatinase A, 72kDagelatinase, 72kDa type IV collagenase) NM_004530 153 855-1007 TTGACGGTAAGGACGGACTC ACTTGCAGTACTCCCCATCG MMP2 Matrix metallopeptidase 2 (gelatinase A, 72kDagelatinase, 72kDa type IV collagenase) NM_004530 227 712-938 CCCAGAGACAGTGGATGATG GCTCATCGTCATCAAAATGG MMP2 Matrix metallopeptidase 2 (gelatinase A, 72kDagelatinase, 72kDa type IV collagenase) NM_004530 160 491-650 GAGAGCTGCAACCTGTTTGT TGCGAGGGAAGAAGTTGTAG MMP25 matrix metallopeptidase 25 NM_022468 182 1022-1203 CTGACAAGTACCGCCTGTCT GTCAAAATTGCCCTCACATC MMP8 Matrix metallopeptidase 8 NM_002424 ? 952-1007 TTG ATT TTG GAG GGA TCT CG TCT TTG TAG CTG AGG ATG CCT TC MMP9 Matrix metallopeptidase 9 NM_004994 MMP9-1 Matrix metallopeptidase 9 NM_004994 183 CTCTGGAGGTTCGACGTG GTCCACCTGGTTCAACTCAC MMS19 MMS19 nucleotide excision repair homolog NM_022362 240 814-1053 GTCCATGACCTCATCTCCAG CAACTTGGCACTCAGAACCT MRC1 mannose receptor, C type 1 NM_002438 168 1256-1483 GGCGGTGACCTCACAAGTAT ACGAAGCCATTTGGTAAACG MRC1 mannose receptor, C type 1 NM_002438 151 1434-1584 CGTTTACCAAATGGCTTCGT CCTTGGCTTCGTGATTTCAT MRC1 mannose receptor, C type 1 NM_002438 198 3465-3665 ACTGCAAGCTTCACAATTCC ATTTCAATTTGGGCTCATCA MRPL42 mitochondrial ribosomal protein L42 NM_014050 211 899-1109 TAAAACGGGCTTCGTGTTAG TAACAATGCTTGGCTGATGA MRPL42 mitochondrial ribosomal protein L42 NM_014050 168 1285-1452 GCCCCTTCCATCAATTCTTA AACCACCCCTTTGTCATTGT MRPL42 mitochondrial ribosomal protein L42 NM_014050 240 308-547 GACTTCTGATGGCAGGACAA CTGTGATACCGTCCATGAGG MSH4 mutS homolog 4 NM_002440 181 2127-2307 TGTCAGATTATGGCCCAGAT TGAGCGATTTGTCATTAGCA MSH5 mutS homolog 5 NM_002441 151 483-633 GTGTGGATTTTGGTCTGGAG CTTAAATCTCCTGGGGGTGT MSH5 mutS homolog 5 NM_002441 203 1555-1757 ATCCCTCTGATTGGCTTCCT TGGTACATCAGCAGCGTCTC MSH6 mutS homolog 6 NM_000179 176 2732-2907 TGCTCTGGAAGGATTCAAAG CATGGTCAAAGGCTGTATCC MSH6 mutS homolog 6 NM_000179 235 521-755 AGGGAAATCAGTCCGTGTTC CTCTGAGGGCTCATCACAAA MSI1 musashi homolog 1 NM_002442 254 142-395 ACTCAGTTGGCAGACTACGC TCTTCTTCGTTCGAGTCACC MSI1 musashi homolog 1 NM_002442 271 2017-2287 CACTCCAAAAACCCAGTGTG ATCCTGGTGGGAAACTTCAG MSI1 musashi homolog 1 NM_002442 277 2597-2873 GCTGTTCGTGTTTTGGGTTT GAGACACCGGAGGATGGTAA MT1 metallothionein 1A NM_005946 224 124-347 CTCCTGCAAATGCAAAGAGT CAGTAAATGGGTCAGGGTTG MT1F metallothionein 1F NM_005949 223 72-294 TTCTTCGCTTCTCTCTTGGA AGCAGCTGCACTTCTCTGAC MT1F metallothionein 1F NM_005949 225 167-391 TTCCTGCAAGTGCAAAGAGT TGTAGCAAATGGGTCAAGGT MT1F metallothionein 1F NM_005949 190 5-194 CCTCCCCTGACTATCAAAGC GCATTTGCACTCTTTGCACT MTHFD2 methylenetetrahydrofolate dehydrogenase 2 NM_006636 146 392-537 CCAGCTTCAATTTCAGAGGA TCCTTGTCTGGAGAAACAGC MTHFD2 methylenetetrahydrofolate dehydrogenase 2 NM_006636 106 1349-1454 CAGGAGCAGCCATTAACCTA TCCTAGAAAAGGCGAATGTG MTHFD2 methylenetetrahydrofolate dehydrogenase 2 NM_006636 263 469-731 TGTTCAGTTGCCTCTTCCAG CCCCATCTGTGTGCAGTAAC MUC1-2 mucin 1, cell surface associated NM_002456 206 545-750 GTGATGTGCCATTTCCTTTC GGGGTACTCGCTCATAGGAT MUC13 mucin 13, cell surface associated mRNA NM_033049 153 2199-2351 CTGGGAATCCAGGAACTTTT GTTTCCTTTGCCTCTCTTCC MUC13 mucin 13, cell surface associated mRNA NM_033049 169 836-1004 CAAGATCTGAAATGCGTGCT TAATCACACCGAAGGGTCAA MUC13 mucin 13, cell surface associated mRNA NM_033049 189 544-732 AATCCTTGCCAAGATGATCC GGCCATGGAATGTTTCTCTT MUC13 mucin 13, cell surface associated mRNA NM_033049 167 68-234 TAAACACAGCCACCAACCAA GGGAGCAGGTGAAGTAGCTG MUC13 mucin 13, cell surface associated mRNA NM_033049 213 1026-1238 GGATGACTGCCTCAATGGTT CACTTTTGGCAGTTCCCATT MUC1-3 mucin 1, cell surface associated NM_002456 157 789-945 TACCGATCGTAGCCCCTATG ACCTGAGTGGAGTGGAATGG MUC1-4 mucin 1, cell surface associated NM_002456 173 530-702 CAGACGTCAGCGTGAGTGAT CAGCTGCCCGTAGTTCTTTC MUM1L1 melanoma associated antigen (mutated) 1-like 1 NM_152423 230 1485-1714 GAAGGTCAAGCCTCTGACAA GCCTCAACAAAAAGCACACT MUS81 MUS81 endonuclease homolog NM_025128 183 1554-1736 CGCACAGCAGACATTAAGGA TGCGTTGAAGTCACTGAAGG MUS81 MUS81 endonuclease homolog NM_025128 228 1902-2129 GAGACACTGCTGAGCACCAT CATGACACATATGGCTGCAA MUS81 MUS81 endonuclease homolog NM_025128 202 774-975 ATACTGCTGGTGCTCTACCG CTGGGGTCAATGAGTACCTG MUS81 MUS81 endonuclease homolog NM_025128 247 547-793 TCCTACAGCACTTCGGAGAC CGGTAGAGCACCAGCAGTAT MYF5 myogenic factor 5 NM_005593 223 974-1192 AGTCCCAAACCAAGACAACA AAGCATTGCAACAAGCTACC MYF5 myogenic factor 5 NM_005593 231 935-1165 GGAGGGCCTAATACACAGGA TGGCCCCCTATCAGAAATAG MYF5 myogenic factor 5 NM_005593 261 500-760 AGATCCTCAGGAATGCCATC TGGATAAGCAATCCAAGCTG MYH6 myosin, heavy chain 6, cardiac muscle, alpha NM_002471 299 GGACTTGATGGTGGACGTAG GCTCATGCACATTCTTTCCT MYH6 myosin, heavy chain 6, cardiac muscle, alpha NM_002471 187 2897-3083 CAAGTTGGAAGACGAGTGCT ATGGGCCTCTTGTAGAGCTT MYH7 myosin, heavy chain 7, cardiac muscle, beta NM_000257 162 5262-5423 AGAACACCAGCCTCATCAAC GCTCCTTCTTCAGCTCCTCT MYH7 myosin, heavy chain 7, cardiac muscle, beta NM_000257 197 AAGAGGCGCTAGAGAAGTCC CCTCTCGTTCATCTCCTTCA MYOT myotilin NM_006790 224 920-1143 ACAGTGGTGCACAAGACTCG AGCTGGCAGTCCACTCACTT MYOT myotilin NM_006790 213 1551-1763 CAAGAAAGATGCTGGGTGGT CGCTGAAATTCTCCTTCTGG MYOT myotilin NM_006790 239 798-1036 AAAGCTGAAATGCAAGGACA TTGCATCCTGATCATTCACA MYOT myotilin NM_006790 209 728-936 AAGCCCATACCAAGAACTCC TCTTGTGCACCACTGTCATC MYOT myotilin NM_006790 173 1282-1454 TGCCAAGAATAGAGCAGGAG AGAAAAGCTTTGGTGGAGGT MYOT myotilin NM_006790 408 917-1069 GATGACAGTGGTGCACAAGA AATGAAACGTGGTGGGTAAA MYOT myotilin NM_006790 221 506-726 CCTCTGCTTTCCCTGCTTCT AGCATTTGCAGTTTGGGATG MYOT myotilin NM_006790 205 949-1153 AACTCAGAACATGCGCGACT ACACATCAGGAGCTGGCAGT MYOT myotilin NM_006790 196 1134-1329 ACTGCCAGCTCCTGATGTGT GACATCCAGCTGCACAGTGA NANOG Nanog homeobox NM_024865 231 1374-1604 TTTTTGAAACGGAGTCTTGC GTGGATCACAAGGTCAGGAG NANOG Nanog homeobox NM_024865 176 286-461 CCTATGCCTGTGATTTGTGG TTCTCTGCAGAAGTGGGTTG NANOG Nanog homeobox NM_024865 244 729-972 ACCTACCTACCCCAGCCTTT CATGCAGGACTGCAGAGATT NBS1 nibrin NM_002485 233 447-679 TTGGTTGCATGCTCTTCTTG GGCTGCTTCTTGGACTCAAC NCAM1 neural cell adhesion molecule 1 NM_000615 240 952-1191 TCAGGTCATTGTGAATGTGC TCAGCCTCGTCGTTCTTATC NCAM1 neural cell adhesion molecule 1 NM_000615 173 1131-1303 TCTTCAGCGACGATAGTTCC TAATTCCATGGCAGTCTGGT NCAM1 neural cell adhesion molecule 1 NM_000615 174 1549-1722 ATATGCCCCAAAGCTACAGG GCAGAGGGGGTGTTGTAGAT NCAM1 neural cell adhesion molecule 1 NM_000615 191 627-817 GTGTGGTTACAGGCGAGGAT GATGACATCTCGGCCTTTGT NDRG1 N-myc downstream regulated 1 NM_001135242 156 684-839 AGGAGCAGGACATCGAGACT TCTCCTGCATGTCCTCGTAG NDRG1 N-myc downstream regulated 1 NM_001135242 158 2082-2239 AGCAGCACACACTTCACAAA CCCCAAATGAGAAAAGGATT NDRG1 N-myc downstream regulated 1 NM_001135242 160 3112-3271 GCTGCCAGGTTCCTGTACTA GGCTGGACTACTTCCTCCTC NEDD9 neural precursor cell expressed, developmentally down-regulated 9 NM_006403 157 3603-3759 TGGTGCTACTACCCCCATTA AGCCACTCTTGAGTGTCAGG NEDD9 neural precursor cell expressed, developmentally down-regulated 9 NM_006403 245 1840-2084 AGCTTGCATCTGAAGAATGG TGTTGCCTCTCAAACTCCTC NEIL1 nei endonuclease VIII-like 1 NM_024608 242 1093-1334 TCCAGACCTGCTGGAGCTAT TGGCCTTGGATTTCTTTTTG NEIL1 nei endonuclease VIII-like 1 NM_024608 241 1176-1416 GACCTGCTGGAGCTATGTCA GTGTGGCCTTGGATTTCTTT NEIL1 nei endonuclease VIII-like 1 NM_024608 254 917-1170 CTTGCAGGAGTACCAGCAGT TCTGCAGCTTGGTCCTTATC NEIL1 nei endonuclease VIII-like 1 NM_024608 114 583-696 GCGTGGAGAAGTCCTCTGTC GCAGAGGGCTCAGTATCAGG NEIL1 nei endonuclease VIII-like 1 NM_024608 222 638-859 ctaccgcatctcagcttcag cggatgtccacgaaacatag NEIL1 nei endonuclease VIII-like 1 NM_024608 161 446-606 gcagtgggaagtcaggttct ggctgacagaggacttctcc NEIL1 nei endonuclease VIII-like 1 NM_024608 250 216-465 ctgactgttcgttggtgctt agaacctgacttcccactgc NEIL2 nei like 2 NM_145043 171 2156-2326 ATATTTGCCAGGCTGGTTTG TTTCCTGCTTTCCAAAATGG NEIL2 nei like 2 NM_145043 204 2460-2663 GGATAGAGTGGCCTGAGAGC GCCCTTGATTCCTGAATTGT NEIL3 nei endonuclease VIII-like 3 NM_018248 164 678-841 GCCTGGAGTAGGGAACATCA GAGCAAGTCCTGCTTTACGG NES nestin NM_006617 277 CTGGAGCAGGAGAAACAGG GTGAGGGGAGGGAAGTTG NFE2 Nuclear factor (erythroid-derived 2), 45kDa BT007288 186 GAGAGATGGAACTGACTTGG CATAAGGTGGTGGAGGAAG NFYA nuclear transcription factor Y, alpha NM_002505 233 4247-4479 GCTGGGAATCTAAGCAACAA TTTGGTAAGGACAGGTTCCA NFYA nuclear transcription factor Y, alpha NM_002505 179 323-501 GTCCAGACCCTCCAGGTAGT GGGACCAACTGTATTTGCTG NFYA nuclear transcription factor Y, alpha NM_002505 184 1930-2113 TTGTCCCTCTGTTGACTGGT TCTCTAGTTTGGCCCTTCCT NFYC nuclear transcription factor-Y gamma NM_008692 214 695-908 CAGTTCTACGACCACCATCC CTGCTGGATCTCTCCTGTGT NFYC nuclear transcription factor-Y gamma NM_008692 250 1548-1797 GCACTCTCCACCACTGCTAA CTCCTGGGTCTGGAGAGAAG NFYC nuclear transcription factor-Y gamma NM_008692 180 1080-1259 CAGCAGCTGTACCAGATCCA CTGGGGCTCTATGGCAAATA NID2 nidogen 2 NM_007361 176 4698-4873 CTGATTTTTGCCATGGATTC TGCACTGATGCAGAGGTAAA NKX2-5 NK2 transcription factor related, locus 5 NM_004387 184 GCCTCAATCCCTACGGTTAT CTCTGAACCGCATTCAAGTC NKX2-5 NK2 transcription factor related, locus 5 NM_004387 253 TCAACAGCTCCCTGACTCTC CTCAGTCCCAGTTCCAACC NKX2-5 NK2 transcription factor related, locus 5 NM_004387 144 1246-1389 CCCTGGATTTTGCATTCACT GGGGACAGCTAAGACACCAG NKX2-5 NK2 transcription factor related, locus 5 NM_004387 183 GGTGGAGCTGGAGAAGACAG GTGGACGTGAGTTTCAGCAC NKX2-5 NK2 transcription factor related, locus 5 NM_004387 292 CATCCTAAACCTGGAACAGCA CAGCTCTTTCTTTTCGGCTCT NKX3-1 NK3 homeobox 1 NM_006167 219 2750-2968 AGGGTAGCCTGAATTGCTTT GCAAGATGGATTCACAAACC NKX3-1 NK3 homeobox 1 NM_006167 221 986-1206 TCTGGCTACCTGTTTGAAGG AACAGGAGGCTTCTGGACTT NKX3-1 NK3 homeobox 1 NM_006167 175 2254-2428 GGACTGAGTGAGCCTTTTGC CAGCCAGATTTCTCCTTTGC NME1 Non-metastatic cells 1, protein NM_198175 225 695-919 GTGGAGAGTGCAGAGAAGGA CTCACAGCTCCAAGAGCTTC NME1 Non-metastatic cells 1, protein NM_198175 184 801-954 CACATTGCTTTTCACATCCA AATCCTATGCTGGGAGGAAG NME1 Non-metastatic cells 1, protein NM_198175 224 245-468 AATCCTATGCTGGGAGGAAG AGATCTTCGGAAGCTTGCAT NME1 Non-metastatic cells 1, protein NM_198175 197 347-543 ACCTTCATTGCGATCAAACC GGCCCTGAGTGCATGTATTT NMNAT3 nicotinamide nucleotide adenylyltransferase 3 NM_178177 151 427-577 CCTGTCAACGACACCTATGG TCAGCACCTTCACTGTCTCC NODAL nodal homolog NM_018055 173 1090-1262 GGGAAACTCCTGGAAGACAT CTTCTTCCTCCCTCTTCCTG NOS2 nitric oxide synthase 2, inducible NM_000625 187 400-587 TATCACAACCTCAGCAAGCA AAAATCCCTTTGGCCTTATG NOS2 nitric oxide synthase 2, inducible NM_000625 158 656-813 ACAAGCCTACCCCTCCAGAT TCCCGTCAGTTGGTAGGTTC NOS2 nitric oxide synthase 2, inducible NM_000625 179 3499-3677 CTCTATGTTTGCGGGGATGT TTCTTCGCCTCGTAAGGAAA NOS3 nitric oxide synthase 3 NM_000603 157 1524-1680 CAGCTAGCCAAAGTCACCAT CCTGATGGAAAACAGGAGTG NOS3 nitric oxide synthase 3 NM_000603 219 4073-4291 TTTCCCTCTCTAGGCCTGTT ACATCTGGCACAGTCCCTTA NOS3 nitric oxide synthase 3 NM_000603 152 2002-2153 TAACCAGCACATTTGGGAAT GTCTGAGCAGGAGATGCTGT NOS3 nitric oxide synthase 3 NM_000603 198 1399-1596 ACCCTCACCGCTACAACATC GCTCATTCTCCAGGTGCTTC NOS3 nitric oxide synthase 3 NM_000603 197 2986-3182 GACGCTACGAGGAGTGGAAG CCTGTATGCCAGCACAGCTA NOS3 nitric oxide synthase 3 NM_000603 171 778-948 CCTACCAGCTTAGGGAGAGC TGGCATACTTGATGTGGTTG NOS3 nitric oxide synthase 3 NM_000603 115 1576-1690 TGAAGCACCTGGAGAATGAG TTGACCATCTCCTGATGGAA NOS3 nitric oxide synthase 3 NM_000603 178 3379-3556 TGCATGACATTGAGAGCAAA ACGTAGGTCTTGGGGTTGTC NOS3 nitric oxide synthase 3 NM_000603 139 3096-3234 CTCCAGCCCCGGTACTACTC TTAGCCACGTGGAGCAGACT NOTCH1 Notch homolog 1, translocation-associated (Drosophila) NM_017617 156 6036-6191 GGACCTCATCAACTCACACG GGTGTCTCCTCCCTGTTGTT NOTCH1-5 Notch homolog 1, translocation-associated (Drosophila) NM_017617 156 5310-5465 TGAGGGCTTCAAAGTGTCTG TTCTTGGTCTCCAGGTCCTC NOTCH1-6 Notch homolog 1, translocation-associated (Drosophila) NM_017617 229 5862-6090 CAACATCCAGGACAACATGG GGACTTGCCCAGGTCATCTA NPPA natriuretic peptide precursor A NM_006172 192 GATCTGCCCTCCTAAAAAGC CCTCTTGCAGTCTGTCCCTA NPPA natriuretic peptide precursor A NM_006172 163 TAGGGACAGACTGCAAGAGG AGGAAGTCACCATCAAACCA NPPA natriuretic peptide precursor A NM_006172 213 GCTGGACCATTTGGAAGAAA TTGCTTTTTAGGAGGGCAGA NPPA natriuretic peptide precursor A NM_006172 156 TCTGCCCTCCTAAAAAGCAA TGTCCTCCCTGGCTGTTATC NPPA natriuretic peptide precursor A NM_006172 250 GAGGGGAACCAGAGAGGAAC GGGCACGACCTCATCTTCTA NPPA natriuretic peptide precursor A NM_006172 154 CTCAGTGAGCCGAATGAAGA TGCTTTTTAGGAGGGCAGAT NPPA natriuretic peptide precursor A NM_006172 238 GCAGACCTGATGGATTTCAA TGCTTTTTAGGAGGGCAGAT NPPA natriuretic peptide precursor A NM_006172 158 5-163 ACAGACGTAGGCCAAGAGAG GTCTGACCTAGGAGCTGGAA NQO1 NAD(P)H dehydrogenase, quinone 1 NM_000903 196 799-994 AAATCCTGGAAGGATGGAAG TTGTCAGTTGGGATGGACTT NQO1 NAD(P)H dehydrogenase, quinone 1 NM_000903 150 437-586 CCCAGATATTGTGGCTGAAC ATGGCAGCGTAAGTGTAAGC NQO1 NAD(P)H dehydrogenase, quinone 1 NM_000903 219 1230-1448 AGAGGCCACTTAGGGAAAGA AGTCCCTTAGGGCAGGTAGA NQO2 NAD(P)H dehydrogenase, quinone 2 NM_000904 199 729-927 GGATTCTACGATTCCGGTTT ATGCAATTTCAGGAGCAAAG NQO2 NAD(P)H dehydrogenase, quinone 2 NM_000904 221 363-583 GTCTATGCACACCAGGAACC GCCAGAGACCTTTGCTTGTA NQO2 NAD(P)H dehydrogenase, quinone 2 NM_000904 154 549-702 GAAACCCACGAAGCCTACAA ACAGCACCCTATCCATCCAG NR5A2 nuclear receptor subfamily 5, group A, member 2 NM_205860 244 2681-2924 CTTTGGCATTGTTGGATTTC TCAATTGCAGCAAGAATGAA NR6A1 nuclear receptor subfamily 6, group A, member 1 NM_033334 189 829-1017 GTCTGTGCCTCCACATTACC TGTGTCACAGCGTATCCATC NSMCE2 non-SMC element 2, MMS21 homolog NM_173685 219 639-857 AAGCAATGTGGTCTTCAAGC GCAATAGGCCTTTTTCTTCC NSMCE2 non-SMC element 2, MMS21 homolog NM_173685 249 206-454 TGGCCCAGGTACTAATTTCA TTTAGTTGCCGATCCAATGT NSMCE2 non-SMC element 2, MMS21 homolog NM_173685 219 723-941 AACTTCACCTGCCCCATTAC ATGGTTCTCAATTGCCCTTC NSMCE2 non-SMC element 2, MMS21 homolog NM_173685 158 667-824 AAGCTGACGGAACAGAAGGA CTCAATCATGCGAACAATGG NTH1 nth endonuclease III-like 1 NM_002528 219 364-582 TGAGCACTGCTATGACTCCA TATTTCACCTTGCTCCTCCA NTH1 nth endonuclease III-like 1 NM_002528 231 229-459 CTCGGACAGTGAGAAAGGTG GTCACCTGGTCTTTGGTTTG NTH1 nth endonuclease III-like 1 NM_002528 247 772-1018 GACCAAGAAGGCAACCAAGT GCGTAAAGCCACTTCACAGA NTN1 netrin 1 NM_004822 230 917-1146 CTCGTACTTCTACGCGGTGT CATGCAGGTTGCAGTTACAG NTN1 netrin 1 NM_004822 191 4657-4847 CTAGCAGCCAGGTCACTGTT CTCAATTCCCATTTCCCTCT NTN1 netrin 1 NM_004822 170 4988-5157 TTCCCCAGTTGTCCTTTTTC TTCCAAGGACAGAAGCAGTG NTN1 netrin 1 NM_004822 238 2858-3095 GGAACCAGCCCTTTTTATGA GGTACTTCACTGAGCCAGCA NTNG1 netrin G1 NM_014917 254 CCATATTTATCACCCGTGGA ATTTGGTTGGTCCACACACT NTNG1 netrin G1 NM_014917 162 1502-1663 TCTCCATGCCACTGTATGTG CAGGTATTTGCAGTGCCTTT NTNG1 netrin G1 NM_014917 270 615-884 AGATTCCTGTCGATTCATGC CGCATCACACTCATTATTGC NTS neurotensin NM_006183 233 44-276 TAGAGAGAGCCCCCTTCAGT TCATCTTCCAAGAGGGAACA NUP43 nucleoporin 43kDa NM_198887 130 855-984 AGTTCACTTTCACCCATCCA ACTGCTTCTTCCTCCTTGGT NUP43 nucleoporin 43kDa NM_198887 100 3673-3772 AGTGGGATCCAAAACACTCA ACAACTGGTGATTGGCTCAT NUP43 nucleoporin 43kDa NM_198887 265 228-492 TGATGGAGGGTTTGAAGGAG AACGATTTCTGGGTTGTTGC NUPL1 nucleoporin like 1 NM_014089 161 634-794 TCAGCTAGCGGTCTGACTCT AAAAGTGAACCTCCCAAACC NUSAP1 nucleolar and spindle associated protein 1 NM_016359 175 81-255 CATTTTCAACCAATGGAAGC GCTCCTCTAGAGAGGGGATG NUSAP1 nucleolar and spindle associated protein 1 NM_016359 178 438-615 CAGATCAGCAACCAGGAAGA CTCTGAGATCCTGGCTTTCC NUSAP1 nucleolar and spindle associated protein 1 NM_016359 140 1067-1206 AACGGGTGTCAGGTTTTCAG ATTTGTGTGTCCCAAGCACA OLIG2 oligodendrocyte lineage transcription factor 2 NM_005806 252 439-690 CCAAGAAGGACAAGAAGCAA CGTAGATCTCGCTCACCAGT OLIG2 oligodendrocyte lineage transcription factor 2 NM_005806 296 83-378 AAATCGCATCCAGATTTTCG CACTGCCTCCTAGCTTGTCC OLIG2 oligodendrocyte lineage transcription factor 2 NM_005806 267 1715-1981 CAGAAGCGCTGATGGTCATA TGAGTCGGTGGGGTAGTTTC OPRM1-mu1 opioid receptor, mu 1 NM_000914 225 285-509 CTTGGCGTACTCAAGTTGCT ACCAGGAAGTTTCCGAAGAG OPRM1-mu1 opioid receptor, mu 1 NM_000914 187 169-355 CTTGGAACCCGAAAAGTCTC TGCCATCTAAGTGGGACAAG OPRM1-mu1 opioid receptor, mu 1 NM_000914 212 85-296 ACGCTCCTCTCTGTCTCAGC GAGTACGCCAAGGCATCAGT OPRM1-mu3 mu3 opiate receptor AY195733 140 1156-1295 AGGAGTCCAGTTTGTGCAAG TGGTTCGTCTTTGTTGAGGT OPRM1-mu3 mu3 opiate receptor AY195733 239 965-1206 GAGAGAGGGTGAGTGCCTTG TACCACGATGGGTTTTGGTT OPRM1-mu3 mu3 opiate receptor AY195733 234 935-1168 AAAAGCCAGTCTTGCTCTGG AAACTGGACTCCTCGGTGTG OR2S2 olfactory receptor, family 2, subfamily S, member 2 NM_019897 AAA GGT CTT CTC CAC CTG CT TAG ATG ATG GGG TTG AGC AT OR2S2 olfactory receptor, family 2, subfamily S, member 2 NM_019897 155 58-212 TGG AAA AAG CCA ATG AGA CC AGG ATG GTC ACC AGG ATG AG OR2S2 olfactory receptor, family 2, subfamily S, member 2 NM_019897 153 751-903 CTG AGG GGA GGA AAA AGG TC GGG GGA TGA GTT TGT CTG AA OSM-3 Oncostatin M NM_020530 243 847-1089 AGGTGCTCTGTGGATGAGAG CCTGAATCAATGGAAAGTCG OSM-4 Oncostatin M NM_020530 235 988-1222 AGACAGAGTCAGGCTGTTGC TTCAGAAACACGGAAAGGAG OSM-5 Oncostatin M NM_020530 226 644-869 TACCATCGCTTCATGCACTC TTCCTCTCATCCACAGAGCA p53-1 Tumor protein p53 (Li-Fraumeni syndrome) NM_000546 250 1377-1626 TCTACCTCCCGCCATAAAA CTCCTCCCCACAACAAAAC PABPC4 poly(A) binding protein, cytoplasmic 4 NM_001135653 199 1592-1790 GGCTTTGGCTTTGTGAGTTA TGTAGAGATTCACCCCCTGA PABPC4 poly(A) binding protein, cytoplasmic 4 NM_001135653 197 971-1167 GCCATGCTGTACGAAAAGTT TCCCTCTGAGACCACATGAT PABPC4 poly(A) binding protein, cytoplasmic 4 NM_001135653 211 1868-2078 AAGGTAATGCTGGAGGATGG CAGGAAGTGCTCTCATTCCA PARP2 poly (ADP-ribose) polymerase 2 NM_005484 166 832-997 GAAGCTGACAGTGGCACAAA TGTCCGGATTAGTGGAGGAG PAX4 paired box 4 NM_006193 177 575-751 ACAGGAGGACCAGGGACTAC TGGAACTCTTTCTCCAGTGC PAX4 paired box 4 NM_006193 249 825-1073 AGGGTCTGGTTTTCCAACAG TTTAGGTGGGGTGTCACTCA PAX4 paired box 4 NM_006193 224 1314-1537 CAGACTGTGGCTCCTTCCTC GGGTGCTCATAGGGAAAACA PAX6 paired box 6 NM_000280 182 7-188 AGTGGGTTTGAAAAGGGAAC ATTGGTGATGGCTCAAGTGT PAX6 paired box 6 NM_000280 254 654-907 GTGTCCAACGGATGTGTGAG CTAGCCAGGTTGCGAAGAAC PAX6 paired box 6 NM_000280 258 455-712 ATTTCAGAGCCCCATATTCG CTGATGGAGCCAGTCTCGTA PBEF1 pre-B-cell colony enhancing factor 1 NM_005746 213 1701-1913 GGCAAGGTGACAAAAAGCTA ATGAAAGGGCAGTATGTCCA PBEF1 pre-B-cell colony enhancing factor 1 NM_005746 191 3150-3340 CTATGGCTGCTTTCCCACTA TCCCTTCCCTAGAAACCAAC PBEF1 pre-B-cell colony enhancing factor 1 NM_005746 183 1437-1619 AATATTGCCTTCGGTTCTGG TGCTGGCGTCCTATGTAAAG PBK PDZ binding kinase NM_018492 238 371-608 ctcattctccttgggctgta tcttggctggctttatatcg PCDH7 protocadherin 7 NM_002589 244 3773-4016 TTTTTACACCCCAACAGCAT GGCAATGGGGAACTAGATTT PCDH7 protocadherin 7 NM_002589 189 197-385 GACTCTGGGCGTCTCTGAAG GCCAGTCTCAACTCCGACTC PCDH7 protocadherin 7 NM_002589 249 3227-3475 CCACAGTTACCCTTCCCAAA CATTCACTTGCACCACCAAC PCDH7 protocadherin 7 NM_002589 157 3073-3229 AATGACACGGGGACCATTTA TGGGAGCATTGTCATTTTCA PCGF1 polycomb group ring finger 1 NM_032673 234 309-542 CTGCTCAACCTCAAACTGGA GCACAGGTTCAACTGCTCAT PCGF1 polycomb group ring finger 1 NM_032673 164 580-743 GCGTCCTGCAGAACAAGTAT GGAGAGCCATATCTGCTTCA PDE2A phosphodiesterase 2A, cGMP-stimulated NM_002599 198 2541-2738 CAGCACCACAGACTTCTCCT TTGCAGCTCAGGGATATAGG PDE2A phosphodiesterase 2A, cGMP-stimulated NM_002599 189 2719-2907 CCTATATCCCTGAGCTGCAA GGAAGTCCAGCGAGTTGTTA PDE2A phosphodiesterase 2A, cGMP-stimulated NM_002599 201 3963-4163 CTTCAAGGCCATATCCACCT CGACAGTTGCACAGAGTCCT PDE3B phosphodiesterase 3B, cGMP-inhibited NM_000922 208 2690-2897 GCTGCCTGTCTTCAAACATT TTGTATTCTGGGCGAGAAAG PDE3B phosphodiesterase 3B, cGMP-inhibited NM_000922 186 1279-1464 TGGGATTGGGACTTAAAACA TGAGAAAGCACCCATTAAGC PDE3B phosphodiesterase 3B, cGMP-inhibited NM_000922 208 1137-1344 CGAAGAAAAAGTGCCTGTGA AACTCCATTTCCACCTCCAG PDE4A phosphodiesterase 4A, cAMP-specific NM_001111307 211 895-1105 AAAAGGATGTTGAACCGTGA ACATGGGCTGTAAGTGTGGT PDE4D phosphodiesterase 4D, cAMP-specific NM_006203 212 1623-1834 CCGGATAATGGAGGAGTTCT ATTCACGATTGTCCTCCAAA PDE4D phosphodiesterase 4D, cAMP-specific NM_006203 176 6179-6354 CAAAGGTGGGTTGATGTCAG GGCAAGTACTGGGAGGATGT PDE4D phosphodiesterase 4D, cAMP-specific NM_006203 166 2289-2454 CAGCGCTCAGGAATATCGTA GCTGCCTGATGAGTCACACT PDE5A phosphodiesterase 5A, cGMP-specific NM_033437 206 2381-2586 AACTGTATGAGGCCCTGACC GGCATATTGCAGAACACACC PDE5A phosphodiesterase 5A, cGMP-specific NM_033437 217 1453-1669 AAGCAAATGGTCACATTGGA TCTGGAAGTTCTGCACAAGG PDE5A phosphodiesterase 5A, cGMP-specific NM_033437 185 67-251 GCATGGTTTGCTGAGAGAGT TCCTTGACAACAATGGGTCT PDE7B phosphodiesterase 7B NM_018945 205 3029-3233 CCATGCCACACATTTGTCTA TGCCAGGAAGGTAAAGTCTG PDE7B phosphodiesterase 7B NM_018945 161 1087-1247 CATTTGCCAAAGGAAATGAC AGCATAAAGTGCCTGTCCTG PDE7B phosphodiesterase 7B NM_018945 246 110-355 TTCTCGATCTCCTTGTGTGC CGGGGTTCTCAAACAAGATT PDE8B phosphodiesterase 8B NM_001029852 177 1709-1885 CTTCCAATGCCTACCACAAC TGCAGAGGAAAGAGTTGGTC PDE8B phosphodiesterase 8B NM_001029852 153 3112-3264 GTTCTTCTGGCCGATGGTAT ATGCCACTTTTTCCCTCATC PDE8B phosphodiesterase 8B NM_001029852 188 2536-2543 ACCTGTAGCATCCCCAAGTC TGGCTTTAGCTGTCAGATGG PDE9A phosphodiesterase 9A NM_001001578 193 500-692 TCTCTCCAGAGACCATCGAG TGGAAGGGGTTGTTTCTGTA PDE9A phosphodiesterase 9A NM_001001578 249 725-973 TGATGTACAGCATGGTCTGG GTGGGATGTTGGAGAAGATG PDE9A phosphodiesterase 9A NM_001001578 170 95-264 AGGCCATCTACCTGGACATC TTTGAATGCTCGGAGAGTTG PDK1 pyruvate dehydrogenase kinase, isozyme 1 NM_002610 204 CATCTTCTAAGGTGGCAGGA CTAACTGCCCATTCACATCC PDK1 pyruvate dehydrogenase kinase, isozyme 1 NM_002610 160 GAACAAAATGCCACGTAACC TTGAGCCCAGAAGATTGAAG PDK1 pyruvate dehydrogenase kinase, isozyme 1 NM_002610 291 527-820 ATACGGATCAGAAACCGACA CAGACGCCTAGCATTTTCAT PDK4 pyruvate dehydrogenase kinase, isozyme 4 NM_002612 226 1319-1544 CTTGCCAATTTCTCGTCTGT TTCTTTTGCCAGGTTCTTTG PDLIM5 PDZ and LIM domain 5 NM_006457 228 126-353 TCATTGGACTTTGAGCCATT TCTGGGCTTCAAGATGAGTC PDLIM5 PDZ and LIM domain 5 NM_006457 229 506-734 TCCACAAACAACATGGCCTA TCAGTGCAGATGGAGACTGG PDLIM5 PDZ and LIM domain 5 NM_006457 230 709-938 TGCTGACCAGTCTCCATCTG TCTTCTTGCTGGCATCACTG PDX1-1 pancreatic and duodenal homeobox 1 NM_000209 154 1212-1365 GGGGCCCTCTTTTAGTGATA GTTAGGGAGCCTTCCAATGT PDX1-3 pancreatic and duodenal homeobox 1 NM_000209 219 1274-1492 TCCTACAGCACTCCACCTTG CAATTTCACGGGATCTTTGA PDX1-4 pancreatic and duodenal homeobox 1 NM_000209 158 1347-1504 CATTGGAAGGCTCCCTAACA TTCCACTGGCATCAATTTCA PEBP1 PEBP1 PEBP4 phosphatidylethanolamine-binding protein 4 NM_144962 216 120-335 GCAGCACTGTTACTGGGTCT GAACTTGACTATCGGCTCCA PEBP4 PFKFB4 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 NM_004567 265 2572-2836 TGAAAATGGCCTTGTGAAGT GAGGCTGGAAAGATGTGCTA PFKFB4 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 NM_004567 230 ACCTGGCTCTTTGTTGACAG GGCCACAGTAGGAACATCAC PFKFB4 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 NM_004567 231 GACAAGCCAGATGAAGAGGA ATGACAGGCTCCAGTCTCTG PGR progesterone receptor NM_000926 200 10262-10461 ACAGGAAAGCAGCACAATTC CCAAAACCCTTCTGGAAAAT PGR progesterone receptor NM_000926 155 9837-9991 TCCGAGCTTAGAGTTGGATG TTCAGGATGCCTCTGCTAAC PGR progesterone receptor NM_000926 182 11495-11676 CTGGCTTAGCACATTCCTCA AGCCTTTTATGCTTGCCTGT PGR progesterone receptor NM_000926 202 11303-11504 ACATGGTAGCTGTGGGAAGG GCTAAGCCAGCAAGAAATGG PIK3C3 phosphoinositide-3-kinase, class 3 NM_002647 232 1297-1528 TGGATTGGAACCTACCAAGA AGCCAGTGTTGAGTTTTTGC PIK3R4 phosphoinositide-3-kinase, regulatory subunit 4 NM_014602 158 3778-3929 TCCAGCTTCTTGGAATTGAG AGTGGCATAGGCAAGAACAG PLTP phospholipid transfer protein NM_006227 170 1257-1426 TTCCGAATCTATTCCAACCA ACCACCTCATGCACAAAGTT PLTP phospholipid transfer protein NM_006227 197 627-823 CAGATCTGCCCTGTCCTCTA AGGCTCCAGTTCCTCTCAGT PLTP phospholipid transfer protein NM_006227 193 719-911 TGGCATTGACTATTCCCTCA CATGGCAGAGTCGAAGAAGA PMEPA1 prostate transmembrane protein, androgen induced 1 NM_020182 169 4089-4257 GAGGCCCTCTTTTCCAGTAG GAAAGGTGGTGATTGACAGG PMEPA1 prostate transmembrane protein, androgen induced 1 NM_020182 234 4491-4724 CGAAGCTTCCAGAACCATAA CTTGAACAGAGCTTGGGAAA PMEPA1 prostate transmembrane protein, androgen induced 1 NM_020182 226 2402-2627 TCAGCTGGCTAAAGGTTCAC GGTGTTTGCTCAACTGCTTT PMS6 PMS6 mRNA D38500 191 678-868 AACTGGCTGAAATTGGTTGG AGGAAAGGGGAGATCTGGAA PMS6 PMS6 mRNA D38500 198 469-666 CTTCTGCCGTGATTGTCAGT CACAAGCAGAGGGAGTTTCA PMS6 PMS6 mRNA D38500 294 648-941 GAAACTCCCTCTGCTTGTGA GTCTTCCTGTGCAGGCTTTA PMS6 PMS6 mRNA D38500 290 378-667 CAGTCAGCGTGAAGCAGTTA TCACAAGCAGAGGGAGTTTC PODXL podocalyxin-like NM_001018111 190 3981-4170 AGGCTTGAGTGAGGTGTTTG AGCCTTTGATTGATTTGCAG POLB polymerase (DNA directed), beta NM_002690 165 659-823 AAGAGGTGCAGAGTCCAGTG CCCATGAACTTTGTCTCACC POLD1 polymerase (DNA directed), delta 1 NM_002691 224 1251-1474 CAGAACTTCGACCTTCCGTA GTGTAGGAGCGGAGCTTGTA POLE polymerase (DNA directed), epsilon NM_006231 152 275-426 CTTAGGCAGTGCAGTGGATT TTTTGCCCTGAAACTTCTTG POLG polymerase (DNA directed), gamma NM_002693 215 3815-4029 CCTTTTTCAGTGCAGTCGAT GAGCAAATACAGAGCCTCCA POLH polymerase (DNA directed), eta NM_006502 189 1074-1262 GTCTTGGAGGAAAGCTAGGG CAATGGTTTTGGGTAGTTGC POLI polymerase (DNA directed) iota NM_007195 169 1364-1532 TGTGTGCTTCTGCAACCTTA GAAATCCCGGTTTGTTTCTT POLK polymerase (DNA directed) kappa NM_016218 153 170-322 ACCATGGATAGCACAAAGGA ATAAAATCTGGACCCCTTCG POLL polymerase (DNA directed), lambda NM_013274 176 1083-1258 CCTGGATAAGTGGGTCTGTG TGACAGGCTTATGGAAGCTC POLM polymerase (DNA directed), mu NM_013284 238 1901-2138 AGTCATGAATGGCAAGTGGT TTATCTTCCTCCCAGCTCCT POLM polymerase (DNA directed), mu NM_013284 152 759-910 GAGGAGGTGGAGAGAGTTCG GTTAGTTTCTGGGGCTGCTC POLM polymerase (DNA directed), mu NM_013284 222 2082-2303 TGTGCTGTAGGCATCTGGAG CAGGGGCTATGTGTGGACTT POLM polymerase (DNA directed), mu NM_013284 283 1081-1363 ACGTGGACTTCCTCATCACC ACGGGTGCAACTACCAAGTC POLN polymerase (DNA directed) nu NM_181808 173 2611-2783 ACTGAGTCTCCCAGCAACAG CGTACAGAGCTGGTGACCTT POLN polymerase (DNA directed) nu NM_181808 181 1322-1502 ATGCCATTCAGGTGAACAAA TTCCTTTGACTCAGCAGGTG POLN polymerase (DNA directed) nu NM_181808 108 625-732 AGCCAGCTGATTGAAATGCT AACAGAAGAAACGGGGGTCT POLN polymerase (DNA directed) nu NM_181808 297 1748-2044 CCAAGCACCCAATTCAGATT ACACCACCTTCTTGGTTTGC POLQ polymerase (DNA directed), theta NM_199420 211 297-507 ATGCAAGCCTACAGTTCCTG TTCTGCCACAAGAGTCTTCC POLQ polymerase (DNA directed), theta NM_199420 161 5827-5987 GTGGTTGGACTGGCAGTATG CGCAAGCAAGATTGAAGGTA POMC proopiomelanocortin NM_001035256 247 1049-1295 CTACAAGAAGGGCGAGTGAG GCTGTTATTTGACGGCTACG POMC proopiomelanocortin NM_001035256 152 63-214 CAGGAGAGCTCGGCAAGTAT TTTGGAGAATCCAGCAAGTG POMC proopiomelanocortin NM_001035256 213 785-997 GGAGTTCAAGAGGGAGCTGA TTCTCGGAGGTCATGAAACC POSTN-1 periostin, osteoblast specific factor NM_006475 156 2090-2245 CAAAACTGAAGGACCCACAC GTTATTTCCACAGGCACTCC POSTN-2 periostin, osteoblast specific factor NM_006475 211 1344-1554 AACGGGCAAATACTGGAAAC GGCTGAGGAAGGTGCTAAAG POSTN-3 periostin, osteoblast specific factor NM_006475 165 313-477 TTTATGGCACTCTGGGCATC TGCTCTCCAAACCTCTACGG POSTN-4 periostin, osteoblast specific factor NM_006475 225 2694-2918 GGGAAATTGTGGAGTTAGCC TGCGTGCATTTTATGTATCC POU2AF1 POU class 2 associating factor 1 NM_006235 171 1978-2148 ACAGTTGCTCCTTTGTTTGC CCTCCTCTGTCCCTCTCTTC POU2AF1 POU class 2 associating factor 1 NM_006235 195 2942-3136 TCCATAAGCCACCATTCTGT TCCCAAGGTACACGTTCACT POU2AF1 POU class 2 associating factor 1 NM_006235 150 478-627 CAAACTGTCGGCTTCAAAGA TTCCTCCTCAGCAGTTCCTT POU2AF1 POU class 2 associating factor 1 NM_006235 168 1771-1938 CCATGGGCTTTCATTTCTGT CCTTGGCTGACTTTCTCAGG POU2F1 POU class 2 homeobox 1 NM_002697 168 235-402 GGTCTGGACTTTCAGAAGCA ATCCCCCGATTCTTCATTAG POU2F1 POU class 2 homeobox 1 NM_002697 240 959-1198 AGAGCCAGTCAACACCAAAG AAAGTGGCTTCAACTTGCAC POU2F1 POU class 2 homeobox 1 NM_002697 170 1803-1972 GACCACCTCCACTCCTTTGT CCATCAGGCTTGGGTTTAGT POU2F1 POU class 2 homeobox 1 NM_002697 246 1572-1817 CAGTGCAGCAACTACCCTCA GGAGTGGAGGTGGTCTGTGT POU5F1 POU class 5 homeobox 1 NM_002701 225 976-1200 GGACCAGTGTCCTTTCCTCT CCAGGTTTTCTTTCCCTAGC POU5F1-2 POU class 5 homeobox 1 NM_002701 229 582-810 GAAGGTATTCAGCCAAACGA GCACTGCAGGAACAAATTCT POU5F1-3 POU class 5 homeobox 1 NM_002701 221 677-897 TGGAGGAAGCTGACAACAAT CCGGTTACAGAACCACACTC POU5F1-4 POU class 5 homeobox 1 NM_002701 184 863-1046 AGAAGGATGTGGTCCGAGTG GTGAAGTGAGGGCTCCCATA PPARGC1A peroxisome proliferator-activated receptor gamma, coactivator 1 alpha NM_013261 194 466-659 GACGTGACCACTGACAATGA GGGTTTGTTCTGATCCTGTG PPARGC1A peroxisome proliferator-activated receptor gamma, coactivator 1 alpha NM_013261 195 2524-2718 CCCTAGCTGAGGATGACAGA TTCAGCAGCTGTGTTCATGT PPARGC1A peroxisome proliferator-activated receptor gamma, coactivator 1 alpha NM_013261 233 814-1046 AGCAGAGACAAATGCACCTC GGGTTATCTTGGTTGGCTTT PPARGC1A peroxisome proliferator-activated receptor gamma, coactivator 1 alpha NM_013261 164 47-210 CCTGCATGAGTGTGTGCTCT GCAAAGAGGCTGGTCTTCAC PPARGC1A peroxisome proliferator-activated receptor gamma, coactivator 1 alpha NM_013261 163 2709-2871 AGCTGCTGAAGAGGCAAGAG TTCCCCTAAACCAAGCACAC PPARGC1B peroxisome proliferator-activated receptor gamma, coactivator 1 beta NM_133263 178 2601-2778 CTCAAGCTCTGGCTCTTCAC GTCGCTGGAGAGATTTTGAA PPARGC1B peroxisome proliferator-activated receptor gamma, coactivator 1 beta NM_133263 245 1892-2136 AGGATCCCTTCAAACCAGAC GAGCACCTGGCAGTAGTCAT PPARGC1B peroxisome proliferator-activated receptor gamma, coactivator 1 beta NM_133263 168 1071-1238 GAGGGAACTTCTGGCTCAAG GAAGCTGCGATCCTTACCTC PPM1K protein phosphatase 1K NM_152542 215 2374-2588 GAGCGAAAAACTCCATCTCA GACTCAGCCTGTGCATTCTT PPM1K protein phosphatase 1K NM_152542 173 560-732 GTCCAGCTACCTGGGACAAT AGCGAAGTCAAACCGATCTT PPM1K protein phosphatase 1K NM_152542 186 1250-1435 ATGCTGATGACAGCTTCCTG AGGCACCAAAAGGCACTACT PRC1 protein regulator of cytokinesis 1 NM_003981 153 1657-1809 TAGCATTCGGCCTATCTTTG AGCTCCAGGTTCTCCTTGTT PRC1 protein regulator of cytokinesis 1 NM_003981 183 1419-1601 TTATGGTGAATGGGCAGAAA GTGTATTGGGAGCCAGTCCT PRC1 protein regulator of cytokinesis 1 NM_003981 241 211-451 CCTAAATCACCTTCGGGAAA TTGCAAGATGGTCGTCTCTC PRC1 protein regulator of cytokinesis 1 NM_003981 223 720-942 TAGACCACACCCCAGACACA GTGGCCACAGCTTCTCTTTC PRC1 protein regulator of cytokinesis 1 NM_003981 241 2782-3022 TGTTCCAATGGGTTGAGCTG CGTGGCTAACACCAAGTCCA PRC1 protein regulator of cytokinesis 1 NM_003981 190 2368-2557 ATCCCTGGGGGTAATTTTGG TAGGGCAGGCCATCTCAACT PRC1 protein regulator of cytokinesis 1 NM_003981 240 993-1232 TGGATCGGTTGGAAGAACTG CCCACTTCTGGACACCTTCA PRDM1 PR domain containing 1, with ZNF domain NM_001198 155 2015-2169 TGAGAGTGCACAGTGGAGAA ATTGCTGGTGCTGCTAAATC PRDM1 PR domain containing 1, with ZNF domain NM_001198 153 2098-2250 TACCTGGTACACACGGGAGA CACAAACTGGGTGAACTTGG PRDM1 PR domain containing 1, with ZNF domain NM_001198 226 840-1065 GGACTTTGCAGAAAGGCTTC TTCTGATGTGAGGGGTGAAA PRDM1 PR domain containing 1, with ZNF domain NM_001198 229 550-778 TACATACCAAAGGGCACACG TGTTCATCCCGTTCTGACAC PRDM1 PR domain containing 1, with ZNF domain NM_001198 173 4821-4993 CCAAAGCATCACGTTGACAT GATTGTGGGCTCAACATTCA PRDM1 PR domain containing 1, with ZNF domain NM_001198 237 1898-2134 ACATGACCGGCTACAAGACC GGCATTCATGTGGCTTTTCT PRKCG Protein kinase C, gamma NM_002739 229 1675-1903 GCTATCGGCCTCTTCTTCCT AGGACCACCAATCGACAGAC PRKCG Protein kinase C, gamma NM_002739 213 1128-1340 GGGCGAGTATTACAATGTGC AAGCTGAAGTCGGAGATGTG PRKCG Protein kinase C, gamma NM_002739 158 1568-1725 GCCTGTATTTCGTGATGGAG CAGGTCCCTGTAGATGATGC PRKCG Protein kinase C, gamma NM_002739 192 1695-1886 TCACAATCAGGGCATCATCT GACTTCCCATAGGGCTGGTA PROM1 Prominin 1 NM_006017 163 1228-1390 TCAGCGTCTTCCTATTCAGG AAAAATCACGATGAGGGTCA PROM1 Prominin 1 NM_006017 210 407-616 CCTCTGGTGGGGTATTTCTT CAGTTTCCGACTCCTTTTGA PROM1 Prominin 1 NM_006017 208 921-1128 AAACTAGCCTGCGGTCATCT AGGGATTGATAGCCCTGTTG PRRX1 paired related homeobox 1 NM_006902 161 1870-2030 TTTGCAATTTCCCAAACAAT TCTCAAACAGCTGCCCTATC PRTN3 proteinase 3 NM_002777 160 532-691 CTGCAGGAGCTCAATGTCAC CCCAGATCACGAAGGAGTCT PRTN3 proteinase 3 NM_002777 174 704-877 GCCTTTTCCCTGACTTCTTC AAGAGCTGCTTCTGTCCAAA PRTN3 proteinase 3 NM_002777 232 329-560 TGGCTCAGGTGTTTCTGAAC GTGACCACGGTGACATTGAG PRTN3 proteinase 3 NM_002777 204 547-750 GTCACCGTGGTCACCTTCTT CCAGTCCACGTAGAGGGCTA PRTN3 proteinase 3 NM_002777 226 374-599 ACGACGTTCTCCTCATCCAG GGGACGAAAGTGCAAATGTT PRTN3 proteinase 3 NM_002777 205 351-555 CTACGACGCGGAGAACAAAC CACGGTGACATTGAGCTCCT PRUNE2 prune homolog 2 NM_015225 233 7810-8042 GCCAGAGACCTGTGAAGAAA CACTATGGCCCAAGAACATC PRUNE2 prune homolog 2 NM_015225 250 6857-7106 GAAGGTGACGGTTCTTGGAT GGCCTTCGGATAATGTCAGT PSG3 pregnancy specific beta-1-glycoprotein 3 NM_021016 168 537-704 TGGACATTTCACCTTCACCT TGAGTCATAGGGAGGCTCTG PSG3 pregnancy specific beta-1-glycoprotein 3 NM_021016 270 85-354 GATCCTAGGCTCAGCTCCAC GTCCTTCATTTGCCCTTTGT PSG3 pregnancy specific beta-1-glycoprotein 3 NM_021016 179 1126-1304 CCAGACCTCCCCAGAATTTA AGCCCGCTATGCTTTGTAGT PSIP1 PC4 and SFRS1 interacting protein 1 NM_021144 163 429-591 TCAAAGGAAGATACCGACCA CAGATGCTGTTGCTGTTGTC PTGS2 Prostaglandin-endoperoxide synthase 2 NM_000963 150 3947-4098 ATGTGCTAGCCCACAAAGAA AACCCACAGTGCTTGACACA PTGS2 Prostaglandin-endoperoxide synthase 2 NM_000963 120 3979-4098 AGCCTGAATGTGCCATAAGA AAAACCCACAGTGCTTGACA PTGS2 Prostaglandin-endoperoxide synthase 2 NM_000963 246 TCTTTGGGGTTACCTCTCTG TGGCTGAACAAATTAACGAA PTGS2-1 prostaglandin-endoperoxide synthase 2 NM_000963 236 GGGAAGAGGGAGAAAATGAA CACATTTGTCTGAGGCACTG PTGS2-2 prostaglandin-endoperoxide synthase 2 NM_000963 170 ACCTCAGCTCAGGACTGCTA CTGAGGCACTAGCCTCTTTG PTGS2-3 prostaglandin-endoperoxide synthase 2 NM_000963 158 932-1089 TGAGCATCTACGGTTTGCTG TGCTTGTCTGGAACAACTGC PTGS2-4 prostaglandin-endoperoxide synthase 2 NM_000963 221 2070-2290 CTGTTGCGGAGAAAGGAGTC TTCAGCATTTTGCCATCTTG PTGS2-5 prostaglandin-endoperoxide synthase 2 NM_000963 218 507-724 tgggaagccttctctaacct ttgaaaaactgatgcgtgaa PTGS2-6 prostaglandin-endoperoxide synthase 2 NM_000963 186 332-517 tctgaaacccactccaaaca aaggcttcccagcttttgta PTGS2-7 prostaglandin-endoperoxide synthase 2 NM_000963 155 1665-1819 gttggagcaccattctcctt ggacagcccttcacgttatt PTK9 twinfilin, actin-binding protein, homolog 1 NM_002822 199 628-826 GGGTGTGGACACTAAGCATC ATCCTTGGGAATCCTCTTTG PTPRC protein tyrosine phosphatase, receptor type, C NM_002838 239 GTGCGGAAACAGAAGAGGTA GGCACCAAGTGGATTAACAC PTPRC protein tyrosine phosphatase, receptor type, C NM_002838 158 3862-4021 CCTGCTCAGAATGGACAAGT TCAGAACCTTCAGCCTGTTC PTPRC protein tyrosine phosphatase, receptor type, C NM_002838 AGCTGGGGTCCACAGACAA GACGCCTCTCCACATTGCT PTPRC protein tyrosine phosphatase, receptor type, C NM_002838 309 1348-1656 CCAGGAGAGCCTCAGATTAT GGAGACAGTCATGTTCCAGA PTPRC protein tyrosine phosphatase, receptor type, C NM_002838 159 3853-4011 AGCACCTACCCTGCTCAGAA TTCAGCCTGTTCCTTTGCTT PTPRN2 protein tyrosine phosphatase, receptor type, N polypeptide 2 NM_002847 152 1747-1898 AACGTGACCACTGAGGATGT TTGGTGGAGTCTTCTTGCTC PTPRN2 protein tyrosine phosphatase, receptor type, N polypeptide 2 NM_002847 227 757-983 GACAGTGGTGTGGACAGACA GTATGAATCCGTGCTCCATC PVRL1 poliovirus receptor-related 1 NM_002855 206 1076-1281 TTCAAGGGACCCATCAACTA ACAATCAACACCAGCAGGAT PVRL1 poliovirus receptor-related 1 NM_002855 236 537-772 ACATCTGCGAGTTTGCTACC GTTCCGGATCTCCTGGTACT PVRL1 poliovirus receptor-related 1 NM_002855 241 1808-2048 TCCAGGAGCTGAACAGAGAC GATGCCCAGGTACACAAGAC RAB13 RAB13, member RAS oncogene family NM_002870 154 847-1000 AGGGAAAAGCAGAAAGGAAA CCTGAAAACCCAGGTAAGGT RAB13 RAB13, member RAS oncogene family NM_002870 212 101-312 AAAGCCTACGACCACCTCTT ATTGTCTTGAACCGCTCTTG RAB13 RAB13, member RAS oncogene family NM_002870 202 771-972 GCAGGGGAGAAATAGCAGAG TGAGGCATCTCTCCTTCCTT RAB27A RAB27A, member RAS oncogene family NM_004580 188 289-476 TGGGAGACTCTGGTGTAGGG CCCTGCTGTGTCCCATAACT RAB27A RAB27A, member RAS oncogene family NM_004580 188 848-1035 AAATGGTCATGCCTCTACGG TAATGGGGATGGTGAGAAGC RAB27A RAB27A, member RAS oncogene family NM_004580 192 1645-1836 TGATTGAAGGGTCAGGGAAC ATAAAGCTGCAGCCTGAGGA RAB33A RAB33A, member RAS oncogene family mRNA BT007038 220 181-400 TTCCCAGACAAGACTGAAGC CTTGGATCCACATTTTGAGG RAB33A RAB33A, member RAS oncogene family mRNA BT007038 231 96-326 GCAGATTCGCATCTTCAAAA TTGCGGTAGTAATGCTCGAC RAB33A RAB33A, member RAS oncogene family mRNA BT007038 270 308-577 TCGAGCATTACTACCGCAAC ACTCCACGTTCTGGCTCTCT RAD23B RAD23 homolog B NM_002874 215 1005-1219 CCAGTTTCAACAACCCTGAC CTGAGGCTGATTCCGTAAAA RAD23B RAD23 homolog B NM_002874 204 428-631 GAGACGGTGAAAGCACTGAA AGTTGTAGCTGGTGCTGGTG RAD23B RAD23 homolog B NM_002874 169 666-834 CTTCCTCCACCACCACAACT GGTGTCTCTGCTGGCTTTTC RAD23B RAD23 homolog B NM_002874 262 763-1024 AGCATCTTCTGAACCTGCAC GTCAGGGTTGTTGAAACTGG RAD51C RAD51 homolog C NM_058216 241 327-567 TACCCAGGGCTTCATAATCA GGCAGTAGCAAGGTCTACCA RAD51L3 RAD51-like 3 NM_002878 193 355-547 TGCAGACCTGGAAGAGGTAG GAGACCAGCATCAAGCAGTT RAD51L3 RAD51-like 3 NM_002878 159 1162-1320 AACAGGTTTCCAGGAGATGG TAAACAGCAGGCGTTACTGG RAD52 RAD52 homolog NM_134424 195 125-319 CTGAGGAAGCAATTCTTGGA GACCCTCAATGTAGCACACC RAD52 RAD52 homolog NM_134424 239 1382-1620 GGCCACATAATTGGACTCTG CACAAGCCGAAGAAAAGGTA RAD52 RAD52 homolog NM_134424 157 1003-1159 ACGCACAGCACTCCTGTAAC CTCTAGACGAGGGCTTGACC RAD52 RAD52 homolog NM_134424 159 583-741 AGTTTTGGGAATGCACTTGG TCGGCAGCTGTTGTATCTTG RAD54B RAD54 homolog B NM_012415 226 936-1161 TGTTTCCCTCTTGTGGATGT TTACTGGCTTGCCTCCATAG RAD54B RAD54 homolog B NM_012415 228 513-740 AAAAAGTGGGAAGGTGATGC ACTTCCTCCTCCAAGCTGAA RAD54B RAD54 homolog B NM_012415 164 256-419 TTCTCCCGTCACAAAATGAT TTTAGGAGCCGAATGAACTG RAD54B RAD54 homolog B NM_012415 181 2647-2827 ATTGTCAGCTTGGTCCACAT GTGCCAGTAGCTTGAGTGGT RAD54L RAD54-like NM_003579 228 839-1066 AATCAACCACCTTGTCTGGA GTCAAGCTTCAGCTGGTCAT RAD54L RAD54-like NM_003579 160 1187-1346 AGGGAGTGAAATTCCTGTGG TCAATTTCTGGCTTGCACTC RANBP2-1 208 ACCAAACATGATGGAACAGG CCATGCCATCCTTAACAAAC RANBP2-2 233 TACTGGAGCAGCTGTGTTTG CCTTCCACTGACTGACATCC RANBP2-3 227 TCTGAAAGCAAAGTGGAACC TCAGCGGTTGGAGTTAGTTC RAPTOR raptor NM_020761 201 923-1123 GAAGGCTCCAAATCCTTAGC TAAATTTGCACCGATGGTTT RASD1 RAS, dexamethasone-induced 1 NM_016084 197 1453-1649 GGGGCATTATCTTGTCTGTG TTTTGTTCGTGTCCATGTTG RASD1 RAS, dexamethasone-induced 1 NM_016084 156 1327-1482 AGCCGAGGGTGGATTTATCT AACCCGGAATCACAGACAAG RASD1 RAS, dexamethasone-induced 1 NM_016084 166 251-416 CGACTCGGAGCTGAGTATCC GCGGATGGAGTAGAACTTGC RB1-2 Retinoblastoma 1 (including osteosarcoma) NM_000321 296 1894-2189 AAAGGACCGAGAAGGACCAA CTGGGTGCTCAGACAGAAGG RB1-3 Retinoblastoma 1 (including osteosarcoma) NM_000321 212 452-663 AAGGAACTGTGGGGAATCTG TCCAATTTGCTGAAGAGTGC RB1-4 Retinoblastoma 1 (including osteosarcoma) NM_000321 251 2860-3110 GCAGAAACTGGCAGAAATGA TCACCCAAACAATTGCATCT RB1CC1 RB1-inducible coiled-coil 1 NM_014781 189 3740-3928 AGGTTGAACTTGCGTTGAAG CTGCTAAGCCCACCTGATAA RCAN1 regulator of calcineurin 1 NM_004414 222 654-875 GCCAGGGGAAAAGTATGAAT CTCCCGTGAGTATGATTTGG RDM1 RAD52 motif 1 NM_145654 174 609-782 TGGAGGAAGGACCATTATCA CTTCTTCGCATCTGACACCT RECQL RecQ protein-like NM_002907 219 348-566 GGTCTTCTGATCTCCCCATT TGCCTTTCCGTAAGTTCTTG RECQL RecQ protein-like NM_002907 171 1419-1589 CAGAAGCCCTCAAACACTGA CAAATTGGCATGGTAAGCAC RECQL4 RecQ protein-like 4 NM_004260 156 614-769 TCACAGTGAGGTCCCAGATT CTGACTTCTTGGAAGGCTGA RECQL5 RecQ protein-like 5 NM_004259 234 454-687 CTGAACTCGAAGCTCTCTGC ACCCAGACGCAAGTAGTCAG RELN reelin NM_005045 222 4036-4257 TTGACCCTGAAACCTGGATA TTCAAAGTCCCCTGTGTGAT REN renin NM_000537 216 268-483 CCGTGATCCTCACCAACTAC GGGTGAGTTCTGTTCCATTG REN renin NM_000537 243 448-690 CCTCCAGCTACAAGCACAAT GGGAGATGATGTTGTCGAAG REN renin NM_000537 192 674-865 CGACAACATCATCTCCCAAG ACCCCCTTCATTTGAATCTG REN renin NM_000537 152 921-1072 ACCGGTGCATCCTACATCTC TATTCTTTGCCTCCCAGGTG REST RE1-silencing transcription factor NM_005612 156 2920-3075 AGGATCTCTCACCACCATCA CAAGACCAGGTAGGCTCTCA RET ret proto-oncogene NM_020630 249 1353-1601 TCCTCTTGCTCCACTTCAAC TGGTGTCATTCACAAACAGG RET ret proto-oncogene NM_020630 175 281-455 TTCTCGAGGGATGCTTACTG GGATGCAGATCCAGTTGTTC RET ret proto-oncogene NM_020630 234 2113-2346 TGTCCTCTTCTCCTTCATCG AATTCCCACTTTGGATCCTC REV3L REV3-like, catalytic subunit of DNA polymerase zeta NM_002912 161 4021-4181 CTCAGTCTGGTGCTGAGGTT AATTCCAGTGGGTAGGGAAG REX1 REX1, RNA exonuclease 1 homolog NM_020695 239 2470-2708 CCCACAGTCCATCCTTACAG GAGCTTCTTGAGGGTGTTCA RGS14 regulator of G-protein signaling 14 NM_006480 168 1735-1902 GCCTTCTGAGGAAAGAGGAC CTGGACTGTTGGGTAGCTGT RGS14 regulator of G-protein signaling 14 NM_006480 182 1336-1517 TGGTACGAATCTCAGCCAAG TGGAAGAGTGTCCAAAACCA RGS14 regulator of G-protein signaling 14 NM_006480 RGS14 regulator of G-protein signaling 14 NM_006480 RGS19 regulator of G-protein signaling 19 NM_005873 208 475-682 CTCCCCAGCTGTGAAGTATG CCTTCTCGTCTACCACATGC RGS19 regulator of G-protein signaling 19 NM_005873 190 683-872 CGAGGCTCATCTACGAGGAC TAGGTGGGAGAGCTGAGGAA RGS19 regulator of G-protein signaling 19 NM_005873 233 1202-1434 TCTTGCGTGGTGAGAGTAGG TTGAGTGCAGGATTCTGAGG RGS19 regulator of G-protein signaling 19 NM_005873 230 753-982 GGAGGGCATCAACAAGAAGA ACCTGAAGGGAACCCAGAGT RGS19 regulator of G-protein signaling 19 NM_005873 233 853-1085 TTCCTCAGCTCTCCCACCTA AGACCCAGGAGACACAGCAC RGS19 regulator of G-protein signaling 19 NM_005873 170 612-781 GAACATGCTCTTCTGGTTGG GCTCCTGCATCTTCTTGTTG RHOC ras homolog gene family, member C NM_175744 214 668-881 CTGACAGCCTGGAAAACATT GAGCACTCAAGGTAGCCAAA RHOC ras homolog gene family, member C NM_175744 163 471-633 CGTCTTCAGCAAGGATCAGT AGTGTCCGGGTAGGAGAGAG RICTOR rapamycin-insensitive companion of mTOR NM_152756 159 8299-8457 TGCCTTTTATCCCCACATTA TCCAAAGAACATTTCCCAAA ROBO1 roundabout, axon guidance receptor, homolog 1 NM_002941 226 248-473 AACCTGCAACTTTGAACTGC CTCACAGCCTCTCCAAGGTA ROBO1 roundabout, axon guidance receptor, homolog 1 NM_002941 204 4605-4808 GGATGGAAGACAGGTTGTTG GAACTGGGATCTCTGGGATT RPA2 replication protein A2, 32kDa NM_002946 244 598-841 CAGTGGGTTGACACAGATGA CTGGATTGCTGATAGGTGCT RPA3 replication protein A3, 14kDa NM_002947 204 107-310 GGATGTGAAGACAATGCACA TCTCTATCCCAGGTGCTCTG RPA3 replication protein A3, 14kDa NM_002947 161 912-1072 CTCTCGCCCTGTATCTGTCA AAGACTAGCGCTCCAGCTTC RPA4 replication protein A4, 34kDa NM_013347 158 1057-1214 TCGGGAGCATTTTAAGTCTG GCAGCGAGTTGACAAAGAAT RPL18A ribosomal protein L18a NM_000980 171 157-327 AGTCCCGCTTCTGGTACTTT GGTATTCCCGGTACATGTTG RPL18A ribosomal protein L18a NM_000980 228 257-484 GGTGAAGAACTTCGGGATCT ATCTTGGAGTCGTGGAACTG RPL18A ribosomal protein L18a NM_000980 193 48-240 GGCACGCTACGAGAGTACAA CAAACACCTGCCCACAGTAG RPL30 ribosomal protein L30 NM_000989 198 267-464 TGGCTAAAACTGGTGTCCAT TTTGCAGGTTTAAGGTTTGC RPL30 ribosomal protein L30 NM_000989 227 179-405 ATGATCAGACAAGGCAAAGC GTCTGTTCTGGCATGCTTCT RPL30 ribosomal protein L30 NM_000989 151 54-204 GCTCCTAAGGCAGGAAGATG AATTTCGCTTTGCCTTGTCT RPL36A ribosomal protein L36a NM_021029 188 208-395 GACAGGAAGCAGAGTGGCTA ATCACTTGGCCCTTTCTCTT RPL36A ribosomal protein L36a NM_021029 168 201-368 GCGTTATGACAGGAAGCAGA CCTCCCAGTTCAAAATGCTT RPL36A ribosomal protein L36a NM_021029 236 134-369 AGCACCAACCCCATAAAGTG TCCTCCCAGTTCAAAATGCT RPL37A ribosomal protein L37a NM_000998 230 161-390 AAATTGAAATCAGCCAGCAC AGGCCAGTGATGTCTCAAAG RPPH1 H1 RNA X15624 216 72-287 GGGAAGGTCTGAGACTAGGG CTCACCTCAGCCATTGAACT RPPH1 H1 RNA X15624 189 104-292 CTAACAGGGCTCTCCCTGAG GGTACCTCACCTCAGCCATT RPPH1 H1 RNA X15624 215 120-334 TGAGCTTCAGGGAGGTGAGT CGGAGGAGAGTGGTCTGAAT RPS18 ribosomal protein S18 NM_022551 154 222-375 CACTGAGGATGAGGTGGAAC GTCTTCACGGAGCTTGTTGT RPS18 ribosomal protein S18 NM_022551 160 82-241 TTGCGAGTACTCAACACCAA GTTCCACCTCATCCTCAGTG RPS18 ribosomal protein S18 NM_022551 170 171-340 TGTGGTGTTGAGGAAAGCAG GGACCTGGCTGTATTTTCCA RPS3 ribosomal protein S3 NM_001005 160 126-285 TGGCTACTCTGGAGTTGAGG CTCTACACTGCCCTCTGGAA RPS6KB2 ribosomal protein S6 kinase, 70kDa, polypeptide 2 NM_003952 200 716-915 GACTTTGGACTCTGCAAGGA ATGGTTTTCTTCCGGTTCTC RPS6KB2 ribosomal protein S6 kinase, 70kDa, polypeptide 2 NM_003952 179 218-396 GAAGAGGTGGAGCTGACTGA TTGGCCTTCCTTAGGACTTT RPS6KB2 ribosomal protein S6 kinase, 70kDa, polypeptide 2 NM_003952 202 600-801 TCTACCTGGCTGAGATCACG ATCTCAGGGGCCATGTACTC RPS6KB2 ribosomal protein S6 kinase, 70kDa, polypeptide 2 NM_003952 167 453-619 AGTCAGTGAAGCACCCCTTT CGTGATCTCAGCCAGGTAGA RPS6KB2 ribosomal protein S6 kinase, 70kDa, polypeptide 2 NM_003952 195 1183-1377 GGTGGACAGTCCTGATGACA CCCTCAAAAGGGGAGAACTT RPS6KB2 ribosomal protein S6 kinase, 70kDa, polypeptide 2 NM_003952 210 1040-1249 GCTGATGTGCAGAGACATCC GTATGTGAAGCCCAGGAAGG RPS6KB2 ribosomal protein S6 kinase, 70kDa, polypeptide 2 NM_003952 175 496-670 CCAGACTGGTGGCAAACTCT CTTGAGGTCCCGGTAGATGA RRM2B ribonucleotide reductase M2 B NM_015713 174 989-1162 GAAAGGGTCAGGGAGATCAT TTCTGCCTGAAAAACCTTTG RSPRY1 ring finger and SPRY domain containing 1 NM_133368 202 1530-1731 ATACACCCATGCTGGAAAGA ATTTGAATGGTTTTGCTCCA RUNX2 runt-related transcription factor 2 NM_001024630 150 AAATGCTGGAGTGATGTGGT TATGAAGCCTGGCGATTTAG RUNX2 runt-related transcription factor 2 NM_001024630 197 #3 CTTGCAGCCATAAGAGGGTA CTGGAGTCCACCTCTCTGAA RUNX2 runt-related transcription factor 2 NM_001024630 TCCTATGACCAGTCTTACCCCT GGCTCTTCTTACTGAGAGTGGAA RUNX2 runt-related transcription factor 2 NM_001024630 156 4503-4658 TTTGCACTGGGTCATGTGTT TGGCTGCATTGAAAAGACTG RUNX2 runt-related transcription factor 2 NM_001024630 298 3403-3700 CAGCAGGTTCCAGCAGGTAG GAAGGGACCCTGACTTTTCG RUNX2 runt-related transcription factor 2 NM_001024630 157 3236-3392 GAGCAAAATTGCACCAGAGA GGACCTACTCCCAAAGGACA RYR2 ryanodine receptor 2 NM_001035 236 4496-4731 TGGACAGAGTTCGCACAGTA TGTACTCGGTTCCACCTGAT RYR2 ryanodine receptor 2 NM_001035 235 7041-7275 CTGTAATGGGGAGAGTGTGG CCCCATGTGGATAGTGTCAT RYR2 ryanodine receptor 2 NM_001035 201 15501-15701 TGGGTTGAGCTATGCAGAAG AGCCTCCTTTTGTCCTGAGA S100A2 S100A2 NM_005978 160 GTAAGGGGGAAATGAAGGAA GTGATGAGTGCCAGGAAAAC S100A2 S100 calcium binding protein A2 NM_005978 160 427-586 GTAAGGGGGAAATGAAGGAA GTGATGAGTGCCAGGAAAAC S100A2-3 S100 calcium binding protein A2 NM_005978 248 194-441 GATCAGGTTGAGGCAGGTTT TCATTTCCCCCTTACTCAGC S100A2-4 S100 calcium binding protein A2 NM_005978 156 159-314 ATGAGTGGGAATGGCAAGAG GCAGAGACAGACCCAGGAAG S100A3 S100 calcium binding protein A3 NM_002960 229 488-716 CAGGTCTTCTGCGATCAGTT TAAATAGGCCCTTTCCCATC SALL1 sal-like 1 NM_002968 155 1004-1158 AGTTCTGGCAACACCATCAT GGTGAGGACGATGATGAGAC SALL1 sal-like 1 NM_002968 231 1823-2053 CCTGAGTCAGCCACAAGAAA AAACTTGGCCTTGAACTGCT SALL1 sal-like 1 NM_002968 190 3507-3696 AGAAACCCTTTGCTTGCACT GCCAAATCCTTCTGGAACAT SALL2 sal-like 2 NM_005407 222 2366-2587 TCTGCCAGAAGAAGTTCACC CCTCTTCCTCCTCCTCAGAC SATB1 SATB homeobox 1 NM_002971 200 1506-1705 TCTTTGCTGGTAAACCTTCG GGTTTCCCATTCCTTTCAGT SATB1 SATB homeobox 1 NM_002971 197 427-623 GCCATCTGATGAAAACCAAC GGCAGCAGAGCTATGTGAAT SATB1 SATB homeobox 1 NM_002971 190 582-771 ATGGCATTGCTGTCTCTAGG GTTTGGGGCAACTGTGTAAC SATB1 SATB homeobox 1 NM_002971 209 1755-1963 CAGGAAATGAAGCGTGCTAA GCGTTGCTCTCCTGTTCATA SC5DL sterol-C5-desaturase-like NM_006918 230 3674-3903 AGAGAGGAGGTCTGGGAGAA AAGGCCCCACCTCTACATAC SC5DL sterol-C5-desaturase-like NM_006918 243 2607-2849 TTCCTCTTTGCCCAGAGACT TGACCCAGAAACATTTTCCA SC5DL sterol-C5-desaturase-like NM_006918 153 4693-4845 CCCAAGCCATGGTTAAAGTT GCCAAAAAGACAGCATCAGA SC5DL sterol-C5-desaturase-like NM_006918 176 2239-2414 GCATGTGTCATGACCTGGAC CCGGGAGAAATGATCAAAGA SC5DL sterol-C5-desaturase-like NM_006918 189 1259-1447 CCAGCACTGCTTCCACTACA ATCTCTGCGTTGCTGAGGTT SC5DL sterol-C5-desaturase-like NM_006918 221 2532-2752 AACAACAAGCAGCACCACAG TCCATGAAGCTGATTTGCAG SC5DL sterol-C5-desaturase-like NM_006918 186 192-377 CATACGTGTATCCAGCCACA TCTCTCGACGGACTTGATTC SC5DL sterol-C5-desaturase-like NM_006918 167 4335-4501 ACCATCTTGAAAGCAGCAAC CCCCCTTGTCTTAGTCCATT SC5DL sterol-C5-desaturase-like NM_006918 184 3355-3538 TATGGAAGTGAGGACCCAAA TACTGCAGAGACAGCATGGA SC5DL sterol-C5-desaturase-like NM_006918 193 5467-5659 GGGTGAAAGACATTGAGGTG CTGGCCTTATGGTTTTAGCA SCARB1 scavenger receptor class B, member 1 NM_005505 178 540-717 AGTTCAGGCACAAAAGCAAC AGGGTCATGGGCTTATTCTC SCARB1 scavenger receptor class B, member 1 NM_005505 233 847-1079 GTTCCCCTTCAAGGACAAGT TGTAGAACTCCAGCGAGGAC SCARB1 scavenger receptor class B, member 1 NM_005505 236 2032-2267 CGTCAACAAGCACTGTTCTG CTGAGTCCCCACTGAATTTG SCD stearoyl-CoA desaturase (delta-9-desaturase) NM_005063 170 1236-1405 CCACTTTCTTGCGATATGCT GGGAAAGGAGTGGTGGTAGT SCGB3A2 secretoglobin, family 3A, member 2 NM_054023 177 148-324 GCTACTGCCTTCCTCATCAA CTCTGGTCCCAGCTCATTTA SCN2A sodium channel, voltage-gated, type II, alpha subunit NM_021007 249 7253-7501 CCCAGCAGCATGACTATCAC ACATGCACCACTGGGTAAAA SCN2A-3 sodium channel, voltage-gated, type II, alpha subunit NM_021007 156 8244-8399 GCTTGAATCCAATGTTTCCA GGTTTTGTGGGAGAGGAAAA SCN2A-4 sodium channel, voltage-gated, type II, alpha subunit NM_021007 234 7774-8010 TTGCAGCAAACAAGGAAGAG TGACTGTGACATCCACCTGA SCN3A sodium channel, voltage-gated, type III, alpha subunit NM_006922 175 7349-7523 TTGCCATCTTCTGCTCTCAG GGAAGCTTGCAAAAGACACA SCN3A-3 sodium channel, voltage-gated, type III, alpha subunit NM_006922 182 6565-6746 GGACTTCAAGAGGAGGTCCA TAGCCATTGGGTTTCTCCTC SCN3A-4 sodium channel, voltage-gated, type III, alpha subunit NM_006922 182 8144-8325 ACCAACTATGGTTGCCTCAA ATTGCACAACTTTGCCACTT SCN3A-5 sodium channel, voltage-gated, type III, alpha subunit NM_006922 192 6023-6215 gtgaccggatccactgtctt tgaatgatagcggcagacac SCN3A-6 sodium channel, voltage-gated, type III, alpha subunit NM_006922 216 8310-8525 ggcaaagttgtgcaattacc ccagaggccaataagtgaaa SCN3A-7 sodium channel, voltage-gated, type III, alpha subunit NM_006922 153 7190-7342 tctgtttcagcaagtgcaaa actgcagcagaaagtggaac SCN5A sodium channel, voltage-gated, type V, alpha subunit NM_000335 198 GGCTGCTCCTAACCTACCTC GTCCCACACTGGACTCAAAG SCN5A sodium channel, voltage-gated, type V, alpha subunit NM_000335 224 4127-4350 AGCTCTGTCACGATTTGAGG AGGACTCACACTGGCTCTTG SCN9A voltage-gated sodium channel Nav1.7 DQ857292 158 TTACCGCTTAAGGCAAAATG GAGAGGTGGTGGATGAAGTG SCN9A voltage-gated sodium channel Nav1.7 DQ857292 153 GCAGATGTGGAAGGATTGTC GATGATGGCCAACACTAAGG SCN9A voltage-gated sodium channel Nav1.7 DQ857292 246 AATTGTAGGGGCTTTGATCC CAAAGGAGAGCATCTTTGGA SCN9A sodium channel, voltage-gated, type IX, alpha subunit NM_002977 179 1610-1788 ataggcgagcacatgaaaag gtctccaaaaatgctgtgct SCN9A sodium channel, voltage-gated, type IX, alpha subunit NM_002977 247 5858-6104 ccacttcatccaccacctct actgcactgccttcgagaat SCN9A sodium channel, voltage-gated, type IX, alpha subunit NM_002977 215 3210-3424 cgtggacaaacacttgatgg ctccaggcaaagggttatca SDCBP syndecan binding protein NM_005625 151 474-624 TAAGCAAGGGATTCGTGAAG TACTTGGTCCCCAAATCTCA SDCBP syndecan binding protein NM_005625 214 66-279 TACACTCGGGCCTCAGAAGT TCCATCGTGAGGGATAGGAG SDCBP syndecan binding protein NM_005625 189 255-443 TTCTGCTCCTATCCCTCACG CCAGTTACAGGAGCCACCAT SEC16A SEC16 homolog A NM_014866 231 2665-2895 GGTGCTTCTGAGAACCTTGA AGCCTCTCTCCAGGACTGAT SEC16B SEC16 homolog B NM_033127 196 1644-1839 AGAAAAGCAGTGGGGAGACT ATGGTCTGTCTTCACGGTGT SEC23A Sec23 homolog A NM_006364 228 622-849 TGTGGTTGATACTTGCATGG ACTTTAGAGAGCCCCAGCAT SEC23B Sec23 homolog B NM_006363 241 654-894 AACCCACTTTGTCAGGTTGA GGGACTCTTTGAGTGCTTGA SEC24A SEC24 family, member A NM_021982 166 1291-1456 ACCACAAGCATGAGTGGATT GCGTGCATCGAAATAACTCT SEC24B SEC24 family, member B NM_006323 160 1406-1565 CAGCCTTCAAAAATGGCTAA GCTGGTTCACACCAGGATAC SEC24C SEC24 family, member C NM_004922 159 325-483 CAGGCTATCAGCAAACACCT GCATCTGAACAGTGGAGCTT SEC24D SEC24 family, member D NM_014822 160 3157-3316 TGGGAAACCCATACTCTCAA GAAGAGCCTCCGTAAAGTCC SELP Selectin P (granule membrane protein 140kDa, antigen CD62) NM_003005 192 ACAACAAAAGGAACAACGAG GGTAACAGGAGCAGGTGTAG SEMA3A sema domain, immunoglobulin domain, short basic domain, secreted, 3A NM_006080 175 1786-1960 GCAATGGAGCTTTCCACTAA CAGTGGGAAAATAGCGAGAA SERPINA1 serpin peptidase inhibitor, clade A NM_000295 152 1221-1372 ATGATCTGAAGAGCGTCCTG AGCTTCAGTCCCTTTCTCGT SERPINB4-3 serpin peptidase inhibitor, clade B NM_002974 206 97-302 TCAGTGAAGCCAACACCAAG TGTTGCAGCTTTTTCTGTGG SERPINB4-4 serpin peptidase inhibitor, clade B NM_002974 175 939-1113 CCTCGGTTCAAAATGGAAGA CTTCCACTCCCTCCTCAGTG SERPINE2 serpin peptidase inhibitor, clade E, member 2 NM_006216 150 1452-1601 CTCCTTTCCTGCATCTTTCA GTACAGTGTTCCAGCCATCC SERPINE2 serpin peptidase inhibitor, clade E, member 2 NM_006216 214 1258-1471 AAGCTTCAGCAGCAACAACT TGAAAGATGCAGGAAAGGAG SFRP2 secreted frizzled-related protein 2 NM_003013 231 1011-1241 ATCTGGTCATGGGACAGAAA CTGAGACTGGAGCAGCTAGG SFTPA1-3 surfactant, pulmonary-associated protein A1B NM_005411 184 22-205 GTGTGGGTCGCTGATTTCTT TCCAACACAAACGTCCTTCA SFTPA1-4 surfactant, pulmonary-associated protein A1B NM_005411 151 178-328 GTGCGAAGTGAAGGACGTTT AGGACATGGCATTTCTCCAG SH3GLB1 SH3-domain GRB2-like endophilin B1 NM_016009 171 995-1165 CCTTCGCTGTCTGAATGACT CCAATCGCATTTGGTAAAAC SH3GLB2 SH3-domain GRB2-like endophilin B2 NM_020145 172 1164-1335 GCTCGGGTGCTCTATGACTA CCTAGCTGAGCAGTTCCAAG SH3GLB2 SH3-domain GRB2-like endophilin B2 NM_020145 214 1388-1601 AGCCCTGCCACTTAACTTGT CTCCTTAGTGGAGCCTGGAG SH3GLB2 SH3-domain GRB2-like endophilin B2 NM_020145 207 1702-1908 CTTTCAGTTGCCAAAAGCTG TGTGGAGAGGTGAAGACTGC SHFM1 split hand/foot malformation (ectrodactyly) type 1 NM_006304 184 77-260 AGGGTTCCAACTTTTCTGCT ATCCCAATTATCCTCCCAGA SIAH1 seven in absentia homolog 1 NM_003031 232 153-384 TACCTCGAAGTGTCCACCAT TTTCTCCATAGCCAAGTTGC SIAH1 seven in absentia homolog 1 NM_003031 248 829-1076 GCGACTCCTCGATCTATTCA TGTCTAGCTTCCACCTACCG SIAH1 seven in absentia homolog 1 NM_003031 227 541-767 GATGCTGTAATGCCCCATCT TGCTTGCGTGTTCCTATCAG SIRT1 Sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) NM_012238 205 ATTTGGGACTGATGGAGATG ACCTTTCTGGTTTCCTTGCT SIRT1 Sirtuin (silent mating type information regulation 2 homolog) 1 NM_012238 153 3149-3301 TGTGGTAGAGCTTGCATTGA GCCTGTTGCTCTCCTCATTA SIRT1 Sirtuin (silent mating type information regulation 2 homolog) 1 NM_012238 240 1144-1383 GTTCCTTTGCAACAGCATCT TGAGGGAAGACCCAATAACA SIRT1 Sirtuin (silent mating type information regulation 2 homolog) 1 NM_012238 239 1983-2221 TTTTTGCCACCAAATCGTTA TCATCTCCATCAGTCCCAAA SIRT6 Sirtuin (silent mating type information regulation 2 homolog) NM_016539 460-620 161 GGGAACATGTTTGTGGAAGA TCTAGGATGGTGTCCCTCAG SIRT6 Sirtuin (silent mating type information regulation 2 homolog) NM_016539 301-499 199 AAGTTCGACACCACCTTTGA GCGTCTTACACTTGGCACAT SIRT6 Sirtuin (silent mating type information regulation 2 homolog) NM_016539 602-848 247 TGAGGGACACCATCCTAGAC GTCATGACCTCGTCAACGTA SIRT6 Sirtuin (silent mating type information regulation 2 homolog) NM_016539 58-209 152 AGGATGTCGGTGAATTACGC TGGAACACCACACTGGAAGA SIRT6 Sirtuin (silent mating type information regulation 2 homolog) NM_016539 493-706 214 AAGACGCAGTACGTCCGAGA ATGTACCCAGCGTGATGGAC SIRT6 Sirtuin (silent mating type information regulation 2 homolog) NM_016539 304-510 207 TTCGACACCACCTTTGAGAG TCGGACGTACTGCGTCTTAC SLC14A1 solute carrier family 14 (urea transporter), member 1 NM_001128588 158 87-244 GGAGGTGGGCAAATCTTTAT CAATCAAAGACCGTCCATTC SLC25A30 solute carrier family 25, member 30 NM_001010875 199 3312-3510 AGGAATTGGGAGACTTGGTC AAGGACAGGAGCCACTTTTT SLC25A30 solute carrier family 25, member 30 NM_001010875 204 649-852 GGGCTGCTATTGTTGTTGGT ATCTGCCATCTCGAAGCACT SLC25A30 solute carrier family 25, member 30 NM_001010875 180 859-1038 GCTACACAGGAACCCTGGAT AGATGTCTCATGCAGCCTTG SLC2A1 solute carrier family 2, member 1 NM_006516 165 2556-2720 ATGCTTGTGGATTGAGGGTA TCTGGGTAACAGGGATCAAA SLC2A1 solute carrier family 2, member 1 NM_006516 297 TGAGGGCCACACTATTACCA TCTGTCTCACTCCCATCCAA SLC2A1 solute carrier family 2, member 1 NM_006516 172 407-578 CATGATTGGCTCCTTCTCTG GCAGTACACACCGATGATGA SLC2A1 solute carrier family 2, member 1 NM_006516 162 AGGAAGAGAGTCGGCAGATG CGAAGATGCTCGTGGAGTAA SLC2A2 solute carrier family 2, member 2 NM_000340 253 3012-3264 TCGTCTCCTTTGACATTTCC CCAGTTGGTGGAGAAAACAG SLC2A2 solute carrier family 2, member 2 NM_000340 217 2700-2916 AATTGAGGACAGCCTGGTTT GTTTCAGAAGCCCACACTCA SLC2A2 solute carrier family 2, member 2 NM_000340 180 240-420 CAGGAGCTAGTCAGGTGCAT ACCTGTTGAGGTGCATTGAT SLC2A2 solute carrier family 2, member 2 NM_000340 246 GATCAATGCACCTCAACAGG GATGCAGTCATTCCACCAAC SLC9A3R1 solute carrier family 9, member 3 regulator 1 NM_004252 198 1523-1720 CTCACTGAGTGCCTCATCCT GTAACAGATGCCCTGTCCAC SLPI-3 secretory leukocyte peptidase inhibitor NM_003064 243 234-476 AATGCCTGGATCCTGTTGAC AAAGGACCTGGACCACACAG SLPI-4 secretory leukocyte peptidase inhibitor NM_003064 167 87-253 CTGTGGAAGGCTCTGGAAAG GTCAACAGGATCCAGGCATT SMAD4 SMAD family member 4 NM_005359 113 631-745 ACGAACGAGTTGTATCACCTGG ATGGCTGTCCCTCAAAGTCAT SMG1 SMG1 homolog, phosphatidylinositol 3-kinase-related kinase NM_015092 221 10997-11217 ACACTGGCCAGAAGACTCAG GGCTTTCACTCTCTTCCACA SMG1 SMG1 homolog, phosphatidylinositol 3-kinase-related kinase NM_015092 181 8534-8714 AAGTGGAACGCTTGAAACAG CCTTCCATCATCAGGTTACG SMG1 SMG1 homolog, phosphatidylinositol 3-kinase-related kinase NM_015092 245 7035-7279 GGAAGCTGCCTTACAAGCAC TTGTGCAAGATGACCAGAGC SMO-2 Smoothened homolog (Drosophila) NM_005631 188 669-856 ACATGCCCAAGTGTGAGAAT CTGGCCTGAACTGTTGAACT SMO-3 Smoothened homolog (Drosophila) NM_005631 224 1740-1963 ATGTGCTATGTCAGGCCAAT CTTTGGCTCATCGTCACTCT SMO-4 Smoothened homolog (Drosophila) NM_005631 187 1271-1457 TGGTTTGTGGTCCTCACCTA CCACAAAACAAATGCCACTC SMUG1 single-strand-selective monofunctional uracil-DNA glycosylase I NM_014311 248 1240-1487 CTCAGTGTTTCCTTGGGAGA CTTGCACTCTGTCACACTGG SMUG1 single-strand-selective monofunctional uracil-DNA glycosylase I NM_014311 196 518-713 AGTGCCCACAGTCAGAAGTG TCACAGATCCCAAGAAGCTG SNAI1 snail homolog 1 NM_005985 217 936-1152 ACCCCACATCCTTCTCACTG TACAAAAACCCACGCAGACA SNAI1 snail homolog 1 NM_005985 157 18-174 GGTTCTTCTGCGCTACTGCT TAGGGCTGCTGGAAGGTAAA SNAI1 snail homolog 1 NM_005985 219 1194-1412 AAGGCTGACAGACTCACTGG CCAAACAGGAGGCTGAAATA SNAI2 snail homolog 2 NM_003068 195 223-417 GCGAACTGGACACACATACA GCCCCAAAGATGAGGAGTAT SNAI2 snail homolog 2 NM_003068 219 1108-1326 ACACACACACACCCACAGAG AAATGATTTGGCAGCAATGT SNAI2 snail homolog 2 NM_003068 200 1618-1817 GGGGAGGAGGGAAAGATTAG GCACTTGGAAGGGGTATTGT SNX30 sorting nexin family member 30 NM_001012994 151 3683-3833 TCCTAGTGAGAGGCAGATGG AATAACATGCCAGGAGGACA SNX30 sorting nexin family member 30 NM_001012994 239 6610-6848 GTTCTGGGCTCTCTGTAGGC ATTGGATAAAGGCCGAGATG SNX30 sorting nexin family member 30 NM_001012994 209 2090-2298 GTCCATGCTTGAGTGAGCAA CCCTGCTCTGATGACAGTGA SOCS3 suppressor of cytokine signaling 3 NM_003955 68 982-1050 TTCAGCATCTCTGTCGGAAGAC CGGCAGCTGGGTGACTTT SOCS3 suppressor of cytokine signaling 3 NM_003955 193 1290-1482 GGGGAGTACCACCTGAGTCT AGAGCAAACAAGTTCCGTTG SOCS3 suppressor of cytokine signaling 3 NM_003955 153 1610-1792 ATCCTGGTGACATGCTCCTC CAAATGTTGCTTCCCCCTTA SOST sclerosteosis NM_025237 232 1491-1722 GCTGACAAACTCCTGGAAGA TCACTTCTCTTCGGAAGGTG SOX2-2 SRY (sex determining region Y)-box 2 NM_003106 185 1299-1483 GACTTCACATGTCCCAGCAC GGGTTTTCTCCATGCTGTTT SOX2-3 SRY (sex determining region Y)-box 2 NM_003106 100 614-713 AACCCCAAGATGCACAACTC GCTTAGCCTCGTCGATGAAC SOX2-4 SRY (sex determining region Y)-box 2 NM_003106 273 1554-1826 ACACCAATCCCATCCACACT TTTTTCGTCGCTTGGAGACT SOX30-2 SRY (sex determining region Y)-box 30 NM_178424 203 2304-2506 CAGGTACCCAAAACATGAGG CATTCTCCAAGGTTCCAATG SOX30-3 SRY (sex determining region Y)-box 30 NM_178424 185 2016-2200 AACTTCGACCATCCAACCTC CGGGTAGGAAGTAAGGGTGA SOX30-4 SRY (sex determining region Y)-box 30 NM_178424 162 1710-1871 TCCCATCACTCATCCAGTTG GGTGGGAGTGCTGGATAGAC SOX30-5 SRY (sex determining region Y)-box 30 NM_178424 185 1237-1421 CAGTCCCTACTGGAGCCTTC GGGTTAGCTTTGGCTAGTGC SOX6 SRY (sex determining region Y)-box 6 NM_017508 221 1720-1940 TGCAGGAATGAAAAGGAAAG TCCCTGTAGACTCGTGCTTC SOX6 SRY (sex determining region Y)-box 6 NM_017508 209 581-789 TGGTGGACACACTGAAACAG GATCAGCTGGGTAATCATGG SOX9 sox9 NM_000346 AGACCTTTGGGCTGCCTTAT TAGCCTCCCTCACTCCAAGA SOX9 SRY (sex determining region Y)-box 9 NM_000346 241 1881-2121 CACACAGCTCACTCGACCTT GGTAATGCGCTTGGATAGGT SOX9 SRY (sex determining region Y)-box 9 NM_000346 168 2965-3132 TCACCTGTGCCTCTCAGAAC CCTTTGAGGAAAGCTCCAAC SPANXB1 SPANX family, member B1 NM_032461 245 48-292 CGAAGATTCAAAAGCTCCAA CCTCCTGTAGCGAACCACTA SPANXB1 SPANX family, member B1 NM_032461 185 176-360 AATGAGGCCAACAAGACGAT TCGGGGTTGATTCTGTTCTC SPANXC SPANX family, member C NM_022661 162 217-378 GCTACAGGAGGAACGTGAAA GCCCAAGGTTGAGAGATGTA SPANXC SPANX family, member C NM_022661 219 102-320 TGTGAATCCAACGAGGTGAA CATGAATTCCTCCTCCTCCA SPDYA speedy homolog A NM_001142634 249 333-581 GCGTCAGGATATGACTGCTT CCTAAAGCCCATGGAAAAAT SPO11 SPO11 meiotic protein covalently bound to DSB homolog NM_012444 152 349-500 TCTGTGGGTCTTCAGATGGT ATGTCCCTTTTGGTTGCATA SPO11 SPO11 meiotic protein covalently bound to DSB homolog NM_012444 203 650-852 AGGAAGATGGCACCAAAGTG AGGAACTCCCTTTCCCGTAA SPON2-1 spondin 2, extracellular matrix protein NM_012445 191 938-1128 ACGGTGACCGAGATAACGTC GGAACTGAGGCGCTGTCTAC SPON2-2 spondin 2, extracellular matrix protein NM_012445 215 433-647 GGCCAAATACAGCATCACCT CCTCGATCTCCTTCATCAGC SPON2-3 spondin 2, extracellular matrix protein NM_012445 243 1265-1507 GAGCTCGAAGAAGAGGCTGA GAAAGGAGGAGGCTGTTTCC SPON2-4 spondin 2, extracellular matrix protein NM_012445 213 1503-1715 CTTTCCCAACCTTGCTTCTT CTCAGCACAGCCTAGAGCAC SPON2-5 spondin 2, extracellular matrix protein NM_012445 106 1669-1774 CACGTGGTTGCAGATACCTC CGCCCCATTTATTCACTTCT SPON2-6 spondin 2, extracellular matrix protein NM_012445 240 1283-1522 GAGTGCGTCCCTGATAACTG AAGAAGCAAGGTTGGGAAAG SPRR2A small proline-rich protein 2A NM_005988 237 262-498 TCCACCGAAGAGCAAGTAAC TTCCTTTGCTCAGTCTCCAC SPRR2B small proline-rich protein 2B NM_001017418 237 264-500 TCCACCGAAGAGCAAGTAAC TTCCTTTGCTCAGTCTCCAC SPRY4 sprouty homolog 4 NM_030964 196 1340-1535 CCAGCTTCGGAAAATACAGA GCAGTTTCCGGATATGTGTC SQLE squalene epoxidase NM_003129 200 1794-1993 AAGTTCAGGAAAAGCCTGGT AAATTCCTTGGCATTTCTCC SQLE squalene epoxidase NM_003129 200 1343-1542 AGCTGTGCTTTCCAGAGATG CCTCTGATTTGCTTTCCTGA SQLE squalene epoxidase NM_003129 176 974-1149 GTTCGGGGACTTCATCACTT AAGGCAGGCCTGAGAGAATA SQSTM1 sequestosome 1 NM_003900 206 917-1122 GAGTTCCAGCACAGAGGAGA AAGACAGATGGGTCCAGTCA ST14 suppression of tumorigenicity 14 NM_021978 204 1286-1489 GACTGCACATGGAACATTGA ATCTGAGTGGAAGCGAACTG STK38L serine/threonine kinase 38 like NM_015000 151 492-642 GAGGAGCTTTTGGAGAGGTG GCACCATCTGCTTCTACCAA STK38L serine/threonine kinase 38 like NM_015000 246 266-511 GTAGCCAAGCTCACATTGGA CACCTCTCCAAAAGCTCCTC STK38L serine/threonine kinase 38 like NM_015000 186 947-1132 CTCACACACAACCCACCAAG CACTCCCAAAGACCACCAGT STOX2 storkhead box 2 NM_020225 152 1716-1867 AAGAAGCACTGATGGAGCAC ATAAGTCTGTGGGGTCACGA STOX2 storkhead box 2 NM_020225 154 3190-3343 TGGCGAACTCAACTCTTGTC GAGCTTTTTCACCCCTTCTG STOX2 storkhead box 2 NM_020225 178 1645-1822 GTTTATTCCACTCGGGGAGA GATCTTCCTCTCCCGTACCA STRADA STE20-related kinase adaptor alpha NM_001003787 193 1874-2066 TAGGTCAGTGAAAGGGCAAG AAGGAATGAGGCACACACAT SULF1 sulfatase 1 NM_001128205 135 2326-2460 CCCAGATTTGTCCATACTCG TTCATCATGACGCTTAGCAA SULF1 sulfatase 1 NM_001128205 199 4028-4226 ATAGCGGGGAAGATGTTGAC AGGGTAGCTTGGAATGTTGG SULF1 sulfatase 1 NM_001128205 163 3662-3824 GACCTTCAAACCCTGCATTT TGAAATCGGTTTCCAGATGA SYNC1 syncoilin, intermediate filament 1 NM_030786 243 1068-1310 GACTCTCTGCCCAGTTTGAA CTCGTTTTTGCCTCACAAGT SYNC1 syncoilin, intermediate filament 1 NM_030786 213 1637-1849 CCAGACAAGAGTGCCAGAAA GCATATGTGAGGGTTGTTGC SYT17 synaptotagmin XVII NM_016524 212 343-554 CCAGTTGGAACCATTAAACG GGACAGAGTCACCATCCTTG TACC2 transforming, acidic coiled-coil containing protein 2 NM_206862 242 8098-8339 GAGACTGAAGCCCTTGTGAA TCAAGTGCACCACAGAGAGA TAZ tafazzin NM_000116 191 604-794 AGACATCTGCTTCACCAAGG AGTCCATCCCCTTCTGGTAG TBC1D3B TBC1 domain family, member 3G NM_001040282 153 1719-1871 CTAGGGACGAACAGCAGTGT GAAGCTTGCTTGGGTTGTTA TBC1D3B TBC1 domain family, member 3G NM_001040282 238 1171-1408 TGTGCTCAAGCATCTTAGGG AGGACAGGGTGTGGAAGAAC TBC1D3B TBC1 domain family, member 3G NM_001040282 186 522-707 TGAAAAACCCCGGAAGATAC CCTCCGGGTTATACTCCTCA TBX1 T-box 1 NM_005992 215 589-803 GCCGACTATATGCTGCTCAT TCGTCCAGTAGGTTGTTGGT TBX1 T-box 1 NM_005992 277 760-1036 GTGTCCTTCGACAAGCTCAA AGTCCTCAGGGTCACAGTCC TBX1 T-box 1 NM_005992 168 1268-1435 CCCAAGTCAGGAGGTCAAGT GCAGCCTCCAACTAATAGGC TBX2 T-box 2 NM_005994 190 TAGCACTAGCCTCCTCACCA CACCAGTCTCTGGATGCTCT TBX2 T-box 2 NM_005994 250 714-963 CTGGACAAGAAGGCCAAGTA GCATGGAGTTTAGGATGGTG TBX3 T-box 3 (ulnar mammary syndrome) NM_016569 210 GTCGGTTGCATTGAGCTACT TGTTCACTTGTCCCGATTTT TBX3 T-box 3 (ulnar mammary syndrome) NM_016569 212 1456-1667 ATTTCACAATTCTCGGTGGA TATAATTCCCCTGCCACGTA TBX5 T-box 5, transcript variant 2 NM_080718 237 464-700 TCCAGAAACTCAAGCTCACC TGGCAAAGGGATTATTCTCA TBX5 T-box 5, transcript variant 2 NM_080718 178 GGTCCCAATACCAGTGTGAG CCCAAGGAAAGGAAAAGGTA TCF1-1 NM_000545 219 1589-1808 GCTCATCACCGACACCAC AGGCTGCTGGAGGACACT TCF12 transcription factor 12 NM_207036 201 3636-3836 CAATGGGGAAGAATTGAGTG GTGGAAGACAGGTTTCATGG TCF12 transcription factor 12 NM_207036 174 1278-1451 AGCTCACAGACAGGTGATGC ATAGCTTGGGGATGAAGGTG TCF12 transcription factor 12 NM_207036 152 2360-2511 CCATCCTGGGCTTAGTGAAA CCCTCCTGTCAGGTTTGTGT TCF12 transcription factor 12 NM_207036 210 927-1136 AAGCCACCAACCAGTATGTT TGGTGAAACTGAGTGTGGAG TCF1-2 NM_000545 205 1109-1314 GCTGAGTACAGAAGCCAAGC CACCTGTGTTGGTGAACGTA TCF1-3 NM_000545 288 CTGCTTCGTGGGATACAGTC GTGAGTAGGTGATGGGGTCA TCF3 Transcription factor 3 NM_003200 275 GAGAAGGAGGACGAGGAGAA AGGATGAGCAGTTTGGTCTG TCF4 NM_003199 299 GCCATTCTCTTCTGCCAAAC CTTCTCACGCTCTGCCTTCT TCF4 Transcription factor 4 NM_003199 190 CCGAAAGTTTCCGAGACAAA AGTGGCCATTTCATCTGGAG TCL1A T-cell leukemia/lymphoma 1A NM_021966 241 400-640 TTTCTGGCGCTTAGTGTACC TGGGTAGAGCTCATCCTCTG TCL1A T-cell leukemia/lymphoma 1A NM_021966 162 537-698 ATGGGGATGTTGTGTTTCTG GGCAGGAGTGGTAGTGCTAA TCL1A T-cell leukemia/lymphoma 1A NM_021966 237 605-841 GGGAGGAATGGACAGACAGA AGTGGGTGTGCAACATGAAA TDG thymine-DNA glycosylase NM_003211 180 1159-1338 CCAAGAGGATGCAAAGAAGA TTAGGAATGCCACTGAAAGC TDP1 tyrosyl-DNA phosphodiesterase 1 NM_018319 223 1281-1503 ATGGCTTATAATGCCCCTTC CAACGCTTGAAAACTGACCT TERF1 telomeric repeat binding factor (NIMA-interacting) 1 NM_017489 186 1552-1737 TGAACCCTGCCACATTTAGT TGGGCAACAGAGAGAAACTC TERT Telomerase reverse transcriptase NM_003219 276 GGTGGATGATTTCTTGTTGG AGACTGGCTCTGATGGAGGT TEX11 testis expressed 11 NM_001003811 205 2513-2717 AGCCTGCACACTATCCTTTG ATGTGGCTCAGAGCATCTTC TEX11 testis expressed 11 NM_001003811 209 1422-1630 GTGGAGACAAGCTGCCAGTA TCCTAGGGTCATGTCGTTCA TEX11 testis expressed 11 NM_001003811 200 2750-2949 TTCTCTGGCTGATGGTCAAG AACTGGGCCCTTGTTGTTAC TEX11 testis expressed 11 NM_001003811 242 2304-2545 GATCCAGACATGCAATGACA CCTTGAGAGCAATCAAAGGA TEX11 testis expressed 11 NM_001003811 220 1217-1436 CTGTTGGGTTTCATTTCCTG GCAGCTTGTCTCCACAGAAT TEX11 testis expressed 11 NM_001003811 243 1332-1574 TGCCAAGGAGAAGATTGAAG TGCAAATTCAGGTAACAGCA TEX11 testis expressed 11 NM_001003811 175 1935-2109 TGAAATGCCGGAATCTGAAG ACATTGCACAGCCAAGTTCC TEX11 testis expressed 11 NM_001003811 237 2447-2683 CAGTGTGGGAGTTGCCTCAT CTTCTTCCAGGGGACAGAGC TEX11 testis expressed 11 NM_001003811 219 2090-2300 GGAACTTGGCTGTGCAATGT GGATCTCCTCAAGTGCACGA TFCP2L1 transcription factor CP2-like 1 NM_014553 160 3185-3344 AGTAAAACCCCGTACCCTTG TTCAGTGGAAGAAGCCAGTC TFDP2-2 transcription factor Dp-2 NM_006286 244 682-925 AAAATGAGCAGCAAAACCAG TTCGCAAGTTTCAGATCCTC TFDP2-3 transcription factor Dp-2 NM_006286 203 357-559 TCGTACAATGAAGTCGCTGA TCCTGAGCAGAATTGGTAGG TFDP2-4 transcription factor Dp-2 NM_006286 220 934-4453 TGCCAAAGGCTTTAGAAGGT CTGCTGGACTGGTGACTGTT TFF1/pS2-3 trefoil factor 1 NM_003225 247 157-403 GAATTGTGGTTTTCCTGGTG AGAAGCGTGTCTGAGGTGTC TFF1/pS2-4 trefoil factor 1 NM_003225 225 46-270 CACCATGGAGAACAAGGTGA GGGACGTCGATGGTATTAGG TFF1/pS2-5 trefoil factor 1 NM_003225 209 160-368 TTGTGGTTTTCCTGGTGTCA CCGAGCTCTGGGACTAATCA TFF1/pS2-6 trefoil factor 1 NM_003225 249 195-443 CAAATAAGGGCTGCTGTTTC CAGAGCAGTCAATCTGTGTTG TFF3 trefoil factor 3 NM_003226 154 416-569 GAGTGCCTTGGTGTTTCAAG CAAAGGGACAGAAAAGCTGA TFF3 trefoil factor 3 NM_003226 158 18-175 TGAACTGACCTCTCCCCTTT AGGAGGCCTCATTTATGCAC TGFB1 transforming growth factor, beta 1 NM_000660 234 ACTACTACGCCAAGGAGGTCA GCCAGGAATTGTTGCTGTATT TGFB1 transforming growth factor, beta 1 NM_000660 106 1368-1473 CGTGGAGCTGTACCAGAAATA TCCGGTGACATCAAAAGATAA TGFB1 transforming growth factor, beta 1 NM_000660 123 NYO CGCCAGAGTGGTTATCTTTTG GCAGTGTGTTATCCCTGCTGT TGFBR3 Transforming growth factor, beta receptor III NM_003243 170 561-730 CTGGCCAGCTACAGAGAGAG ACCCTCAGACACCAAAAACA TGFBR3 Transforming growth factor, beta receptor III NM_003244 241 2760-3000 ATTCTCACACAGGGGAGACA AAATCCAGCCCTCTGAGTCT TGFBR3 Transforming growth factor, beta receptor III NM_003245 179 3887-4065 TGGTAGGGTGAGTGTTTCCA ATGAGTGCCCTTTTCCAATC TGFBR3 Transforming growth factor, beta receptor III NM_003246 151 1800-1950 CCAAGATGAATGGCACACAC CCATCTGGCCAACCACTACT TIE1-10 Tyrosine kinase with immunoglobulin-like and EGF-like domains 1 NM_005424 133 1285-1417 GGAGCCAGAGAAGACCACAG GGGCACTTTCACATTGACCT TIE1-11 Tyrosine kinase with immunoglobulin-like and EGF-like domains 1 NM_005424 236 3033-3268 TGCTGGTCGGAGAGAACCTA ATAGAGCTCGGCACAGGTCA TIE1-12 Tyrosine kinase with immunoglobulin-like and EGF-like domains 1 NM_005424 338 3232-3569 TACACCCTACTGTGGCATGA GGTCAGACTGGTCACAGGTT TIE1-3 Tyrosine kinase with immunoglobulin-like and EGF-like domains 1 NM_005424 210 2582-2791 GAGTGGGAGGACATCACCTT CAGGAGGTTGATGATGTTGG TIE1-4 Tyrosine kinase with immunoglobulin-like and EGF-like domains 1 NM_005424 81 1228-1308 CAGCATAGAGCTACGCAAGC TCAGCTGTGGTCTTCTCTGG TIE1-5 Tyrosine kinase with immunoglobulin-like and EGF-like domains 1 NM_005424 251 535-785 GCAGACAGACGTGATCTGGA CACCTCCATGTAGGCAACCT TIE1-6 Tyrosine kinase with immunoglobulin-like and EGF-like domains 1 NM_005424 182 2887-3068 GACTGACCCAGCTTTTGCTC CTGCAATCTTGGAGGCTAGG TIE1-7 Tyrosine kinase with immunoglobulin-like and EGF-like domains 1 NM_005424 211 2908-3118 AGAGCATGGGACAGCCTCTA CCCCATCGTCTTCTTCACAT TIE1-8 Tyrosine kinase with immunoglobulin-like and EGF-like domains 1 NM_005424 178 3550-3727 AACCTGTGACCAGTCTGACC GGGCAGCTGAACTAGAAAGA TIE1-9 Tyrosine kinase with immunoglobulin-like and EGF-like domains 1 NM_005424 193 939-1131 ACCCCTATGGCTGCTCTTGT GGGATCCGGTCTGACTTCTC TIMP2 TIMP metallopeptidase inhibitor 2 NM_003255 243 2765-3007 TATAACACCCCACCCCTGTT AAGGAATCCACCTGCATAGG TIMP2 TIMP metallopeptidase inhibitor 2 NM_003255 179 722-900 GAAGAAGAGCCTGAACCACA AGCCGTCACTTCTCTTGATG TIMP2 TIMP metallopeptidase inhibitor 2 NM_003255 173 2988-3160 CCTATGCAGGTGGATTCCTT AAAAGACCAACGTGTGTGGA TIMP2 TIMP metallopeptidase inhibitor 2 NM_003255 196 1935-2130 GAAAAAGCTGGGTCTTGCTG AGTGTCCTGGAGGCTGAGAA TIMP3 timp3 NM_000362 126 CCCCATGTGCAGTACATCCA GCACAGCCCCGTGTACATCT TJP2 tight junction protein 2 NM_004817 174 1588-1761 GGGATATTGCAGGCACAGTT CGCTGTCTCCCTTCTTGAAC TJP2 tight junction protein 2 NM_004817 223 2796-3018 AGCTGGTTTGGCAGCTTAAA GCTCATCCAGCTCATTGTCA TJP2 tight junction protein 2 NM_004817 156 355-510 GAGACAACCCCCACTTTGAA GCTGAACTGCAAACGAATGA TJP2 tight junction protein 2 NM_004817 240 1717-1956 ATGGCCCTAATACCAAAATG TGGTCACCATTTCACCTTTA TJP2 tight junction protein 2 NM_004817 166 1137-1302 AGCAGAGCGAACGAAGAGTA TTCGAGCATCCGTTAAAGAC TJP2 tight junction protein 2 NM_004817 196 2684-2879 AAATCCAACGTCCAACAAAA CATCCCTTCCATCTTTCCTT TLR1-2 Toll-like receptor 1 NM_003263 214 1126-1339 GGGTCAGCTGGACTTCAGAG AAAATCCAAATGCAGGAACG TLR1-3 Toll-like receptor 2 NM_003264 155 2474-2628 ATTCCGCAGTACTCCATTCC TTTGCTTGCTCTGTCAGCTT TLR1-4 Toll-like receptor 3 NM_003265 190 5-194 ACTGCCAAATGGAACAGACA TGCCCAATATGCCTTTGTTA TLR2 toll-like receptor 2 NM_003264 376 ACTGGACTTCTCCCATTTCC ATAAAACAGCACCCCAGACA TLR2 toll-like receptor 2 NM_003264 344 TGCTCCTGTGAATTCCTCTC TCCCGCTCACTGTAAGAAAC TLR2 toll-like receptor 2 NM_003264 267 CCCCCTTCAAGTTGTGTCTT TCATTATCTTCCGCAGCTTG TLR2 toll-like receptor 2 NM_003264 189 2171-2359 ATGCCTACTGGGTGGAGAAC TGCACCACTCACTCTTCACA TLR2 toll-like receptor 2 NM_003264 201 283-484 TCCTCCAATCAGGCTTCTCT AATTCCATTGGATGTCAGCA TLR3-2 toll-like receptor 3 NM_003265 170 74-243 GAAAGGCTAGCAGTCATCCA CATCGGGTACCTGAGTCAAC TLR3-3 toll-like receptor 3 NM_003265 113 1610-1722 GCCTCTTCGTAACTTGACCA TGTTATGCTGCAAATCGAGA TLR3-4 toll-like receptor 3 NM_003265 266 879-1144 CTGTCCACCACCAGCAATAC TCATCAATCTTGGGGAGTGA TLR6-3 Toll-like receptor 6 NM_006068 152 1636-1787 ATAAAAGCAGGGGACAATCC TCCTTTAGTGGGCTTCCTCT TLR6-4 Toll-like receptor 6 NM_006068 245 1411-1655 CCTCCCAGGATCAAGGTACT GGATTGTCCCCTGCTTTTAT TLR6-5 Toll-like receptor 6 NM_006068 221 1893-2113 GGATCTGCCCTGGTATCTCA TCTTGCCAGGGACAAAGTTC TLR7-3 Toll-like receptor 7 NM_016562 173 4770-4942 ACAAAGGTGTTTGTGCCATT TTGGGAATTTGTGACCCTTA TLR7-4 Toll-like receptor 8 NM_016563 157 230-386 CCTAAAACTCTGCCCTGTGA CTGGGGAGATGTCTGGTATG TLR7-5 Toll-like receptor 9 NM_016564 165 3297-3461 TTGCAAAACACAACTGCCTA AAACCCCATCTTTCCAACTC TLR8-3 Toll-like receptor 8 NM_138636 208 1236-1443 CTGATGCAGCTTCCAAACTT AATCTGTTGAGCGTCGTTTC TLR8-4 Toll-like receptor 9 NM_138637 249 1170-1425 GGGCATTGCATTTAAGAGGT TCCGGATATGACGTTGAAAA TLR8-5 Toll-like receptor 10 NM_138638 167 82-248 TCCTTCAGTCGTCAATGCTG CGTTTGGGGAACTTCCTGTA TMSB4X thymosin beta 4, X-linked NM_021109 153 166-318 CCTTCCAAAGAAACGATTGA TTGATCCAACCTCTTTGCAT TNCRNA trophoblast MHC class II suppressor mRNA AF508303 197 55-251 AGCTGCGTCTATTGAATTGG CATCCCCAAGTCATTGGTTA TNF Tumor necrosis factor (TNF superfamily, member 2) NM_000594 219 748-966 CATCTATCTGGGAGGGGTCT TTTTGAGCCAGAAGAGGTTG TNF Tumor necrosis factor (TNF superfamily, member 2) NM_000594 186 273-458 TCTTCTCCTTCCTGATCGTG GAGGGTTTGCTACAACATGG TNF Tumor necrosis factor (TNF superfamily, member 2) NM_000594 217 60-276 CCCTGAAAACAACCCTCAGA AAGAGGCTGAGGAACAAGCA TNF Tumor necrosis factor (TNF superfamily, member 2) NM_000594 208 932-1139 TCCTTCAGACACCCTCAACC CAGGGATCAAAGCTGTAGGC TNF Tumor necrosis factor NM_000594 186 78-263 TCTTCTCCTTCCTGATCGTG GAGGGTTTGCTACAACATGG TNF Tumor necrosis factor NM_000594 268 122-389 CTGCTGCACTTTGGAGTGAT GGACCTGGGAGTAGATGAGG TNF Tumor necrosis factor NM_000594 134 241-374 AGCCCATGTTGTAGCAAACC TGAGGTACAGGCCCTCTGAT TNFRSF19 NM_018647 192 238-429 GTCTAAGGAATGTGGCTTCG TAAAATCCTGGCAAGCAGTC TNFRSF19 NM_018647 175 733-907 ACCTCAGCTCCACGAATATG GTTTCTTGCCTGAAGACTGG TP73 tumor protein p73 NM_005427 156 2080-2235 CCTTCCTGTGTGTCCAAAAC AGGTTCTGCAGGTGACTCAG TP73 tumor protein p73 NM_005427 247 490-736 TTGAGGTCACTTTCCAGCAG GCAGACTGTCCTTCGTTGAA TP73 tumor protein p73 NM_005427 179 1012-1190 ACCGAAAAGCTGATGAGGAC TCGCACCTGAAGGTAGTACG TP73 tumor protein p73 NM_005427 156 2524-2679 ATGTCCCTAACTGCGTCTTG CCCAGTTTTCTCCAATTTCA TP73 tumor protein p73 NM_005427 200 2449-2648 TGCGACATCTTTTGGTTCTG GTTGTTGTTAGGGGCAGGAA TP73 tumor protein p73 NM_005427 171 2083-2253 TCCTGTGTGTCCAAAACTGC CACTAGGGCAGCTCCAGAAG TPPP tubulin polymerization promoting protein NM_007030 173 4159-4331 TGGAATCCGTAATTGCATCT GAAGCTAATTGGCAGTGCAT TPPP tubulin polymerization promoting protein NM_007030 177 5795-5971 GCTGATGTCTAAACCGCACT TAACGACAGCAGACACAGGA TPPP tubulin polymerization promoting protein NM_007030 212 3824-4035 CTGTGGGTTTCGTGAATGAG GAGTGGAGAAGGGTGCTCTC TPPP tubulin polymerization promoting protein NM_007030 236 1616-1851 GAAGTGCCGAGACACTCCTC AGAAACCCCCACAGACACTG TPR translocated promoter region NM_003292 233 3368-3600 GAGCCATAGAGAGCATGGAA CTCCTTCGCAGCTTGTAGAG TREM2 triggering receptor expressed on myeloid cells 2 NM_018965 238 370-607 GGTGGCACTCTCACCATTAC GGATTTCTCCTTCCAAGAGG TREX2 three prime repair exonuclease 2 NM_080701 244 681-924 ACGAGTCTGGTGCCCTAGTA AGCAGGGGGAAATCATAATC TREX2 three prime repair exonuclease 2 NM_080701 231 190-420 GGCTAGGTGGAGGTTACTGC TCTAGGCGGCCTTTAATCAG TRIB tribbles homolog 1 NM_025195 160 1193-1352 GGGACCTGAAGCTTAGGAAG GTGGTGTTGAGGATCTCAGG TUBA4A Tubulin, alpha 4a NM_006000 187 953-1139 GCCAACCAGATGGTAAAGTG TGGGAGGCTGGTAGTTGATA TUBA4A Tubulin, alpha 4a NM_006000 154 200-353 TCCTTCACCACCTTCTTCTG CATCCTCTTTCCCAGTGATG TUBA4A Tubulin, alpha 4a NM_006000 185 263-447 GATCTGGAGCCTACGGTCAT GTGCACTGGTCAGACAGCTT TUBA4A Tubulin, alpha 4a NM_006000 208 309-516 GACAGCTCTTCCACCCAGAG AGGAGTGAGGTGAAGCCAGA TUBB2C tubulin, beta 2C NM_006088 237 766-1002 TATGGTGACCTGAACCACCT CATCATGTTCTTGGCATCAA TUBB2C tubulin, beta 2C NM_006088 223 1145-1367 ATGTGAAAACGGCTGTCTGT TACTCGGACACCAGGTCATT TUBB2C tubulin, beta 2C NM_006088 222 463-684 AGAAAGGAGGCTGAGAGCTG TTCTACGAGCTGGTGGACTG TUBB2C tubulin, beta 2C NM_006088 235 968-1202 TCACCCAGCAGATGTTTGAT AAGGTGGCGGACATTTTTAG TUBB8 tubulin, beta 8 NM_177987 224 355-578 GTTGTCAGAAAGGAGGCTGA ATGAGCTGGTGGACTGAGAG TUBB8 tubulin, beta 8 NM_177987 196 76-271 GATGAACATGCCATCGACTC TGAAGTTGTCTGGCCTGAAG TUBB8 tubulin, beta 8 NM_177987 216 655-870 ACACCCACCTATGGTGACCT GGTAAGCTCAGCCACAGTCA TULP4 tubby like protein 4 NM_020245 184 10106-10289 AATTCCTGAGTGTGCTCTGC CAAACGACATTTTGGACACA TULP4 tubby like protein 4 NM_020245 232 6031-6262 GAAGAGGTCTTCGGAGATGC TCCTGAAAGAACAGCAGGTG TULP4 tubby like protein 4 NM_020245 130 4006-4135 GGGCTATGAGAGGATCACCA CCTCAAGGTGGCAGAGCTAC TUSC1 tumor suppressor candidate 1 NM_001004125 198 1104-1301 GGAGCAGCCTCTACAGGAAC GGCACCGTAGTCCAAGGTAT TUSC1 tumor suppressor candidate 1 NM_001004125 242 130-371 GAATGCCGTGTAAAGAGCAA GTGTCCTGTCTCCTGTGGTG TUSC1 tumor suppressor candidate 1 NM_001004125 159 1482-1640 AACTGGGTGCCAAGAAACAC GCTGAAGGCTTTAGGGGATT TUSC1 tumor suppressor candidate 1 NM_001004125 150 1395-1544 TGTACAGTTCCCCTGCCTCT CAACAGGTTCGCACAACATC TWIST1 twist homolog 1 NM_000474 178 1174-1351 GTGGACAGTGATTCCCAGAC TTTCCTTTCAGTGGCTGATT TWIST1 twist homolog 1 NM_000474 159 647-805 GTCCGCAGTCTTACGAGGAG CCAGCTTGAGGGTCTGAATC TWIST2 twist homolog 2 NM_057179 155 1154-1308 TTACTTTCACGCCGCTATTC CAGGATACACAGCCACACTG TXNIP thioredoxin interacting protein NM_006472 190 2569-2758 acctccaaatactgccatga agaaaagggtggagctcagt TYR tyrosinase NM_000372 280 100-379 GTACTGCCTGCTGTGGAGTT GTTGAATCCCATGAAGTTGC TYR tyrosinase NM_000372 203 705-907 TGCCTTGGCATAGACTCTTC GACAATCTGCCAAGAGGAGA TYR tyrosinase NM_000372 292 1209-1500 AGGTACAGGGATCTGCCAAC CGACTCGCTTGTTCCAAATA UBC ubiquitin C NM_021009 215 217-431 GGACATTTTAGGACGGGACT AGCGATCCACAAACAAGAAC UBE2A ubiquitin-conjugating enzyme E2A NM_003336 223 1353-1575 GGAATGGAAACAATCGTGAG CAGATGCTGAAAGGGAAGAA UBE2B ubiquitin-conjugating enzyme E2B NM_003337 156 1642-1797 GACTTGTTTTGCTGCTTGGT TACACCAAGATTTCCCTCCA UBE2B ubiquitin-conjugating enzyme E2B NM_003337 178 536-713 TATTTGGACCAGAAGGGACA GTTGGACTCCATCGATTCTG UBE2E1 ubiquitin-conjugating enzyme E2E 1 NM_003341 198 234-431 GCAAACCGAGAAAGAAACAA GGCCCTAGAATGGTTGATCT UBE2E1 ubiquitin-conjugating enzyme E2E 1 NM_003341 172 661-832 GACCCCTTGGTGGGAAGTAT CTCCCTGACCCCTTCAAAAT UBE2E1 ubiquitin-conjugating enzyme E2E 1 NM_003341 228 282-509 CAGCATGAGCAAAAACTCCA TTTGGAGGCTTGAAGGGATA UBE2V2 ubiquitin-conjugating enzyme E2 variant 2 NM_003350 197 153-349 AAGGTGGACAGGCATGATTA GCCATTTTGCTAACACTGGT UBLCP1 Ubiquitin-like domain containing CTD phosphatase 1 NM_145049 235 TGGCTCTCCCTATCATTGT TCACGAGTTCCCATCATC UC145 71 46-115 GCTGCTTGGTGTCAGAAATC AGGGCCAGGCAGATCTATTA UC145 96 46-141 GCTGCTTGGTGTCAGAAATC CAAGGCAGATATTGAAAAGCA UC145 79 80-158 GCGTGGATGGGAATTTCTAA AGCCGGCACTAATAGTCCAA UC145 84 Jan-84 GCAGCGAACCCTGCTAAATA CACGCGCCTCATACATATTG UCK2 uridine-cytidine kinase 2 NM_012474 197 439-635 GGATGCCTTTGACAATGAAC TCATCTGGAACAGGTCTCGT UCK2 uridine-cytidine kinase 2 NM_012474 248 768-1015 TCTGCTTGCCAACAAAGAAG CCCTCCTCTGTCTCTTGGAG UCK2 uridine-cytidine kinase 2 NM_012474 218 355-572 CCTGAGCCAGGATAGCTTCT CGTCTGCGGGATAGACAGTA UCP3 uncoupling protein 3 NM_003356 152 149-300 CTCTCCTTGGACCTCCTCTC GAAAGGTAACGAGGTCAGCA UCP3 uncoupling protein 3 NM_003356 177 1292-1468 GAGGAGGAGGGATTCTGGTC CACGTCTCCAACCTTCCATT ULK1 unc-51-like kinase 1 NM_003565 243 3410-3652 ATCTGTGCCTGACCTTTCTG TGATCCCCACCTGTAAAAGA ULK2 unc-51-like kinase 2 NM_014683 166 929-1094 TCGCAGAAAATCAAGTGTCA CCACAAGTCAGCCTTAGCAT ULK3 unc-51-like kinase 3 NM_001099436 232 1490-1721 TCGGAATCTGTTCGTAGCTC ACAGCCATCAAACCATCTGT ULK4 unc-51-like kinase 4 NM_017886 216 3027-3242 CCAAAATGTGGAGTGGAGAC GCGACTAGCAGTTTCAGAGC USF2 upstream transcription factor 2, c-fos interacting NM_003367 234 999-1232 TGCAGGAGACCTTCAAAGAG TGTCCCTCTCTGTGCTAAGG USF2 upstream transcription factor 2, c-fos interacting NM_003367 244 315-558 GCACAGAGACAAATGGAGGA AAGGGATTTTGGATCACAGC USF2 upstream transcription factor 2, c-fos interacting NM_003367 194 686-879 GGAGGCCAGTTCTACGTCAT TGGACGATCCAGTTGTTGAT USP2 ubiquitin specific peptidase 2 NM_004205 151 3463-3613 AACTCTGTGCTGTCCTGGAG TCTCTGGAGAAGGGTGTCAG USP2 ubiquitin specific peptidase 2 NM_004205 162 2826-2987 AAGCACAGCCACAGTAGACC GATATTTCAGGAGGGGCAGT USP2 ubiquitin specific peptidase 2 NM_004205 164 1372-1535 GGAGTTCCTTCGCTTTCTTC GATCCCCGATCCTACTGTCT USP34 ubiquitin specific peptidase 34 NM_014709 167 10320-10486 AGCATGCAGAAGAACAGTCC GCCATCACAGCTTCTCAAGT USP34 ubiquitin specific peptidase 34 NM_014709 232 7272-7503 TCACTCGCTTTGTGAGAACC TCTTCCCCTTCTTCCTCTGA USP34 ubiquitin specific peptidase 34 NM_014709 162 9629-9790 TGCATCAAGCTTTTGTGTGA ATTGGCACAGTTTGCTTCAG USP7 ubiquitin specific peptidase 7 NM_003470 157 959-1115 AAAAGCGTCCCTTTAGCATT TATCGAGCAACACTCGACAA USP7 ubiquitin specific peptidase 7 NM_003470 215 3884-4098 TGCAGCTAGCAAGTCTTGTG GCTGACGAGGTGAGACAAGT USP7 ubiquitin specific peptidase 7 NM_003470 175 1686-1860 ACAATTATGGGGGTCACGAT TTCTGAGCCTCGATCCTTTT USP9X ubiquitin hydrolase X98296 193 400-592 AAGCATGTCAGCGATTTTTC TGGAATTTGCAATGAGGATT USP9X ubiquitin hydrolase X98296 164 2352-2515 GATTACCTTTGGAGGGTCGT GAAGCCTTCAGACGATCAAA USP9X ubiquitin hydrolase X98296 174 6995-7168 TGAACTTCTCTGGCAGGTTG TTAGAGCGCTGGATTGTGTC USP9X ubiquitin hydrolase X98296 198 3784-3981 CAGGATGTGGGTCGTTACAG ATGTCTGCCAAGCCTTTTCT UTF1 undifferentiated embryonic cell transcription factor 1 NM_003577 165 908-1072 ACCAGCTGCTGACCTTGA CTGGAGAGGGGAGACTGG UTF1 undifferentiated embryonic cell transcription factor 1 NM_003577 193 952-1144 GCCTTCGACCAGACAGTG TCCTTTTATTGAACATACCCAAG UTF1 undifferentiated embryonic cell transcription factor 1 NM_003577 340 633-972 GTCCCCACCGAAGTCTGC GGACACTGTCTGGTCGAAGG UVRAG UV radiation resistance associated gene NM_003369 186 3769-3954 TGTCCTGCATAACAGCTTCA GGCTTCTGCAGATCCAGTTA VAV3 vav 3 guanine nucleotide exchange factor NM_006113 203 4339-4541 CGGGAATGTTTTGTCTGTTG AAGGGGCTCCAATATCCTCT VAV3 vav 3 guanine nucleotide exchange factor NM_006113 245 1783-2027 GAGAAACGGACCAATGGACT CAAGGCTTGACTGCATCACT VCAM1 vascular cell adhesion molecule 1 NM_001078 153 610-762 TTTCTGGAGGATGCAGACAG TACAGCCTGCCTTACTGTGG VCAM1 vascular cell adhesion molecule 1 NM_001078 201 2097-2297 GTTGAAGGATGCGGGAGTAT TTCATGTTGGCTTTTCTTGC VDR vitamin D (1,25- dihydroxyvitamin D3) receptor NM_000376 189 3999-4187 CCACCTCAGCCTTGGATAAT TTTTCCTCCCAGCTCCTAGA VDR vitamin D (1,25- dihydroxyvitamin D3) receptor NM_000376 224 676-899 CAGACACACTCCCAGCTTCT TCTTAGCAAAGCCAATGACC VDR vitamin D (1,25- dihydroxyvitamin D3) receptor NM_000376 203 572-774 GCCCACCATAAGACCTACGA AGATTGGAGAAGCTGGACGA VEGFA-3 Vascular endothelial growth factor NM_001025366 231 2062-2292 AGACACACCCACCCACATAC TGCCAGAGTCTCTCATCTCC VEGFA-4 Vascular endothelial growth factor NM_001025366 245 2608-2852 CGCTTACTCTCACCTGCTTC GGAAGGTCAACCACTCACAC VEGFA-5 Vascular endothelial growth factor NM_001025366 166 1503-1668 TCCCGGTATAAGTCCTGGAG AACGCGAGTCTGTGTTTTTG VIM vimentin NM_003380 185 1001-1185 TCCAAGTTTGCTGACCTCTC TCAACGGCAAAGTTCTCTTC WDR45L WDR45-like NM_019613 236 626-861 TCTGTGTCCTTTGTCCCAAT CTGGATTAAATGCCCTGATG WDR45L WDR45-like NM_019613 151 1784-1934 AATGTTTCCCCTCGTGTGAG GCTTCTAGAGTGGCCTGGTG WDR45L WDR45-like NM_019613 224 1377-1600 CCTAAGGACTCCCATTTCCA GCTGCAAAAACAAACCTGAA WFDC5 WAP four-disulfide core domain 5 NM_145652 216 262-477 CTGCTACAGAGCTTGCTTCC GCAGAGCCACAGATCCTAAA WFDC5 WAP four-disulfide core domain 5 NM_145652 205 437-641 CCTGCCAGAGGCTAATTCTG GACTCCCAGGAGGAGAAACC WIPI1 WD repeat domain, phosphoinositide interacting 1 NM_017983 172 864-1035 TCTTCAAGCTGGAACAGGTC CTCTGTCCGGAGAAGTTCAA WIPI2 WD repeat domain, phosphoinositide interacting 2 NM_015610 152 2997-3148 GTTGGCTTTACGGCAAACTA CAAGCAGGTTTTGAAGGAAA WISP1 WNT1 inducible signaling pathway protein 1 NM_003882 222 2145-2366 AGACCCACTGAAATGACCAA ACCGGTAAACCTCCATCTTC WISP1 WNT1 inducible signaling pathway protein 1 NM_003882 177 #3 AAGGCAGGGAAGAAGTGTCT ATCAGGACACTGGAAGGACA WISP1 WNT1 inducible signaling pathway protein 1 NM_003882 CCAGCCTAACTGCAAGTACAA GGCGTCGTCCTCACATACC WISP1 WNT1 inducible signaling pathway protein 1 NM_003882 154 2518-2671 TTCTGTGCCAGACATTGCTC CCAACTGGGTGACTCTGGTT WISP1 WNT1 inducible signaling pathway protein 1 NM_003882 295 1422-1716 ACTACACCCAAGCCTGATCC TGGCAAATGTTTGATGACCT WISP1 WNT1 inducible signaling pathway protein 1 NM_003882 273 1222-1494 GTGAAGCAGTCAGCCCTTAT TTTCTTGGGATTTAGGCAAG WISP3 WNT1 inducible signaling pathway protein 3 NM_003880 160 227-386 AGATGCACCTCAGCGTAAAC ACAGAGGTCAGCTTCATTGC WNT10B wingless-type MMTV integration site family, member 10B NM_003394 157 2024-2180 TTGGGAAAGAGACAGAGTGC AGGAAAAAGAGGCTCCAAGA WNT3A wingless-type MMTV integration site family, member 3A NM_033131 176 384-559 GGACAAAGCTACCAGGGAGT ACTCGATGTCCTCGCTACAG WNT3A wingless-type MMTV integration site family, member 3A NM_033131 160 244-403 TGCAGGAACTACGTGGAGAT ACTCCCTGGTAGCTTTGTCC WNT3A wingless-type MMTV integration site family, member 3A NM_033131 192 543-734 TAGCGAGGACATCGAGTTTG CACCAGCATGTCTTCACCTC WNT3A wingless-type MMTV integration site family, member 3A NM_033131 152 2249-2400 CCACACCGTCAGGTACTCCT TGTAGCTGGATGGAGTGCAG WNT3A wingless-type MMTV integration site family, member 3A NM_033131 173 288-460 CAAGATTGGCATCCAGGAGT ATGAGCGTGTCACTGCAAAG WRN Werner syndrome NM_000553 208 3283-3490 ACATTCGCCAAGTCATTCAT TTTTCCATCTTTGCCATCAT XAB2 XPA binding protein 2 NM_020196 215 1978-2192 TCTACCAGAAGGCCATTGAG TTCCTTGATGGTGTCCTCAT XCL1 DONE - see cytokine list XRCC2 X-ray repair complementing defective repair in Chinese hamster cells 2 NM_005431 191 655-845 TTCTTTTTGCAACGACACAA AAATTGGTTGCTGCTTTGAG XRCC4 X-ray repair complementing defective repair in Chinese hamster cells 4 NM_003401 250 531-780 GCAGAAAATCAAGCCAAAAA AGATTGCAGTTTCCCCTTCT YBX1 Y box binding protein 1 NM_004559 229 398-626 ACAGGAATGACACCAAGGAA CTACGACGTGGATAGCGTCT YBX1 Y box binding protein 1 NM_004559 208 885-1092 TCGGGGATATAGACCACGAT ATCGGCTGCTTTTGTCTCTT YBX1 Y box binding protein 1 NM_004559 187 973-1159 GGAGATGAGACCCAAGGTCA GGTAAGCCGGCATTTACTCA ZEB1 zinc finger E-box binding homeobox 1 NM_001128128 180 818-997 GAAAATGGAACACCAGATGC GTGACGTTCAAGTTGGGTTC ZEB1 zinc finger E-box binding homeobox 1 NM_001128128 157 1143-1299 CATATGAATGCCCAAACTGC GATGCTGAAAGAGACGGTGA ZEB1 zinc finger E-box binding homeobox 1 NM_001128128 190 2153-2342 GCACAACCAAGTGCAGAAGA CATTTGCAGATTGAGGCTGA ZEB2 zinc finger E-box binding homeobox 2 NM_014795 246 1462-1707 CACATCAGCAGCAAGAAATG AAACCCGTGTGTAGCCATAA ZEB2 zinc finger E-box binding homeobox 2 NM_014795 214 1770-1983 ATCTGCTCAGAGTCCAATGC TTGTTCCTCAGGTTGAGAGC ZEB2 zinc finger E-box binding homeobox 2 NM_014795 220 469-688 CCGCTCTTATCAATGAAGCA ACTCATGGTTGGGCACACTA ZFP42 zinc finger protein 42 homolog NM_174900 173 968-1140 CAATCGCTTGTCCTCAGAGT CGGCTTCTCTCCAGTATGAA ZNF43 zinc finger protein 43 NM_003423 225 3711-3935 ATGGTGGCTCATGCCTATAA AATGGTATGATTTCGGCTCA ZNF43 zinc finger protein 43 NM_003423 255 418-672 CCAAAAAGCGACACTGAGAA TTGCCACATTCTTTGCATTT ZNF43 zinc finger protein 43 NM_003423 273 284-556 CTGATCACCTGTCTGGAGCA CTGGGTAGCTGGCAAACATT

Submitted by: Diego Arango

Institution: Albert Einstein Cancer Center/Montefiore Medical Center