Transcription factor SL1



Reverse Primer: 5'- ATTGGTAAAGCAGGGTGAGC - 3'


Product Size: 187 b.p.

Primer Concentration: 0.2 micromolar

Annealing Temperature: 55°C

Magnesium Chloride Concentration: 4 mM

Instrument: Roche LightCycler


Submitted by: Steven W. Johnson, Ph.D.

Institution: University of Pennsylvania