Inositol 1,4,5-trisphosphate 3-kinase B (ITPKB), mRNA

 

Forward Primer:5'- GCACTGTGCAGGGGTTTGTAAC -3'

Reverse Primer: 5'- CGAAAGGCTGGACTCCTGTTTC - 3'

 

Product Size: 331 b.p.

Primer Concentration: 0.2 micromolar

Annealing Temperature: 55°C

Magnesium Chloride Concentration: 4 mM

Instrument: Roche LightCycler

 

Submitted by: Steven W. Johnson, Ph.D.

Institution: University of Pennsylvania