Bone gamma-carboxyglutamate (gla) protein (osteocalcin)

 

Forward Primer:5'- ATGAGAGCCCTCACACTCCTC -3'

Reverse Primer: 5'- GCCGTAGAAGCGCCGATAGGC - 3'

 

Product Size: 284 b.p.

Primer Concentration: 0.2 micromolar

Annealing Temperature: 65°C

Magnesium Chloride Concentration: 4 mM

Instrument: Roche LightCycler/Cephiad SmartCycler

 

Submitted by: Phoebe S. Leboy

Institution: University of Pennsylvania