Msh homeo box homolog 2 (Drosophila)

 

Forward Primer:5'- CCCTGAGGAAACACAAGACC -3'

Reverse Primer: 5'- GCCATTTTCAGCTTTTCCAG - 3'

 

Product Size: 239 b.p.

Primer Concentration: 0.2 micromolar

Annealing Temperature: 59°C

Magnesium Chloride Concentration: 4 mM

Instrument: Roche LightCycler/Cephiad SmartCycler

 

Submitted by: Phoebe S. Leboy

Institution: University of Pennsylvania