V-abl Abelson murine leukemia viral oncogene homolog 1

 

Forward Primer:5'- GTCTGAGTGAAGCCGCTCGT -3'

Reverse Primer: 5'- GGCCACAAAATCATACAGTGCA - 3'

 

Product Size: 101 b.p.

Primer Concentration: NA

Annealing Temperature: NA

Magnesium Chloride Concentration: NA

Instrument: NA

 

Submitted by: Unknown

Institution: Unknown