Glyceraldehyde-3-phosphate dehydrogenase

 

Forward Primer:5'- TCAACGACCCCTTCATTGAC -3'

Reverse Primer: 5'- ATGCAGGGATGATGTTCTGG - 3'

 

Product Size: 531 b.p.

Primer Concentration: 0.2-0.4 micromolar

Annealing Temperature: 57.5°C

Magnesium Chloride Concentration: 4 mM

Instrument:

 

Submitted by:

Institution: