Platelet/endothelial cell adhesion molecule

 

Forward Primer:5'- ATGGAAAGCCTGCCATCATG -3'

Reverse Primer: 5'- TCCTTGTTGTTCAGCATCAC - 3'

 

Product Size: 235 b.p.

Primer Concentration: 0.5 micromolar

Annealing Temperature: 55°C

Magnesium Chloride Concentration: 4 mM

Instrument: Roche LightCycler

 

Submitted by: Dr. Steven Albelda

Institution: University of Pennsylvania