Tapasin

 

Forward Primer:5'- GAGCCTGTCGTCATCACCAT -3'

Reverse Primer: 5'- AGCACCTTGAGGAGTCCGAG - 3'

 

Product Size: 848 b.p.

Primer Concentration: 100 micromolar

Annealing Temperature: 58°C

Magnesium Chloride Concentration: 1.5 mM

Instrument: Perkin Elmer DNA thermal cycler

 

Submitted by:

Institution: