Symbol Name Accession Size Region Forward Reverse 1110007M04Rik RIKEN cDNA 1110007M04 gene NM_026742 163 313-475 GTTGAACCACGACAAGAACC CGATTTTCTCAGCAGTCCAT 1110007M04Rik RIKEN cDNA 1110007M04 gene NM_026742 240 2436-2675 GGATTGCCTTTATGGGAGTT TGTGAGACCCCAATACCAGT 1110007M04Rik RIKEN cDNA 1110007M04 gene NM_026742 241 553-793 CCTCCAGAAGACAGGAAAGC GGCCACATGATCAATACAGC 6430706D22Rik RIKEN cDNA 6430706D22 gene NM_198652 154 1651-1804 GCTATTTCAGCACCAAGCAT CAGCTTTCATTGGCGATACT a nonagouti NM_015770 306 311-616 AAGGCTTCGATGAAGAAGGT CCACAAGTCACAACCACTGA a nonagouti NM_015770 158 416-616 ACTCAACCCCAACTGCTGAC CCCACAAGTCACAACCACTG a nonagouti NM_015770 438 179-616 GACAGGAGTCTGCGGAGTAA CCACAAGTCACAACCACTGA a nonagouti NM_015770 114 210-323 ACTCGCTGGATTTCTCCTCT TCATCGAAGCCTTTTTCTTG a nonagouti NM_015770 277 45-321 GCTGATGCGGAGTAGAGTCA ATCGAAGCCTTTTTCTTGGA a nonagouti NM_015770 137 62-198 TCACTTGTGCTGCTTCTCAG TTACTCCGCAGACTCCTGTC A2bp1 ataxin 2 binding protein 1 NM_183188 218 1160-1377 GTTATGCTGCGTACCGCTAT AGCCTGCAATGAAGAGAGAA A2bp1 ataxin 2 binding protein 1 NM_183188 171 610-780 GATCCAGACCTCCGACAAAT GATTTTACGGCCCTCTACCA A2bp1 ataxin 2 binding protein 1 NM_183188 224 1311-1534 CTTGACCGATGCCAAGACTA GCATGTGATGCAACACTCAG A2bp1 ataxin 2 binding protein 1 NM_183188 242 389-630 agaccactgtccctgaccac catttgtcggaggtctggat A2bp1 ataxin 2 binding protein 1 NM_183188 108 738-845 gagggagaaattgcacggta ccattggtgtaggggttgac A2bp1 ataxin 2 binding protein 1 NM_183188 152 56-207 ggctctcggctttgtagttg cacgccataagaatgcagaa A730008L03Rik RIKEN cDNA A730008L03 gene NM_021393 163 TGTGAGGCTGTGGAGAACTG ACCACTGAGGGAGGACCTTT A730008L03Rik RIKEN cDNA A730008L03 gene NM_021393 264 AGCTGTACGACATGGTGCTG AATCCCCCAAAACTTGTTCC A730008L03Rik RIKEN cDNA A730008L03 gene NM_021393 153 CCTGAAAGAGACCCTGACCA TCCCTAGCGCAGAACCTTTA Abca1 ATP-binding cassette, sub-family A, member 1 NM_013454 205 3083-3287 CAACTTTTACGAAGGCCAGA AGTCAGCATGTCAAACAGCA Abcf1 ATP-binding cassette, sub-family F (GCN20), member 1 NM_013854 212 2828-3039 CCACACTGGCTCAGTCTCTT TTTGGTGAAACAGTCCAGGT Abcg1 ATP-binding cassette, sub-family G, member 1 NM_009593 228 3691-3918 CTGAAAAGAATGGGTGTTGG ACCTGGACAGGAAAGAATCC Abl1 c-abl oncogene 1, receptor tyrosine kinase NM_001112703 209 2416-2624 CTGGTAGGGGAAAACCACTT GGTGACATGCCATAGGTAGC Acat1 acetyl-Coenzyme A acetyltransferase 1 NM_144784 200 1868-2067 CGCAGAAACCAGAGAAATGA GCTTGGGAGAGTCAAGGAAC Acat1 acetyl-Coenzyme A acetyltransferase 1 NM_144784 174 2296-2469 GCAAACAAAACAGAGCAGGA ATTCTCTGGCTGGCTTGAAT Acat1 acetyl-Coenzyme A acetyltransferase 1 NM_144784 191 3047-3237 GAACCGAGAAACGATCCAAA ACCAAACCTCCGTCACTGTC Acat1 acetyl-Coenzyme A acetyltransferase 1 NM_144784 156 1256-1411 ATATGGCTCATGCCCTGAAG GCCCAAGGGAGTCACATTTA Acat2 acetyl-Coenzyme A acetyltransferase 2 NM_009338 180 1859-2038 GCTGAGGTGGGGTAGGTATT CAGTCATCATTTTGGGGAAG Acat2 acetyl-Coenzyme A acetyltransferase 2 NM_009338 154 946-1099 TAGGACCAATTCCAGCCATA CCATCGATGTTGACCTTCTC Acat2 acetyl-Coenzyme A acetyltransferase 2 NM_009338 164 266-429 TCCTACTCGACAAGCCAGTG TCATATTCTCCATGCCTCCA Acat2 acetyl-Coenzyme A acetyltransferase 2 NM_009338 187 1269-1455 CCACCACCTTGGACAGTTCT AGCCCTTGATGACTGATTGG Acly ATP citrate lyase NM_134037 248 647-894 GCACCTGAGGACAAGAAAGA TCTGCAATGTAGGCTTCCTC Acta2 actin, alpha 2 NM_007392 160 1013-1172 ATGCAGAAGGAGATCACAGC CAGCTTCGTCGTATTCCTGT Actb actin, beta NM_007393 160 791-950 AAGAGCTATGAGCTGCCTGA TACGGATGTCAACGTCACAC Actb actin, beta NM_007393 228 469-696 AGCCATGTACGTAGCCATCC CTCTCAGCTGTGGTGGTGAA Actb actin, beta NM_007393 165 304-468 TGTTACCAACTGGGACGACA GGGGTGTTGAAGGTCTCAAA Actb actin, beta NM_007393 233 817-1049 GGTCATCACTATTGGCAACG TGCTAGGAGCCAGAGCAGTA Acyp2 acylphosphatase 2, muscle type NM_029344 173 6-178 CATACCCAGCTAATGCTGCT GTGCCTTTGCTTGTGTTCTT Acyp2 acylphosphatase 2, muscle type NM_029344 170 86-255 GACAGTGCAAGGTGTTTGCT TAGGACTCCCAACCTTGCTC Adipoq adiponectin NM_009605 211 304-514 ACTCCTGGAGAGAAGGGAGA GAATGGGTACATTGGGAACA Adipoq adiponectin NM_009605 233 142-374 CTCTTAATCCTGCCCAGTCA CCAACATCTCCTGTCTCACC Adipoq adiponectin NM_009605 194 123-316 GTTGCAAGCTCTCCTGTTCC TCTCTCCAGGAGTGCCATCT Afp alpha fetoprotein NM_007423 173 497-669 TGCAAAGCACATGAAGAAAA TTTGTCTGGAAGCACTCCTC Afp alpha fetoprotein NM_007423 192 959-1150 TGCTGCAAATTACCCATGAT AAGGTTGGGGTGAGTTCTTG Agt angiotensinogen NM_007428 168 930-1097 GAATTCTGGGTGGACAACAG GTCGAGATCTGAGGTGCAGT Agt angiotensinogen NM_007428 200 640-839 TGCTACAGTCCATTGTGGTG CTCCAGTGGCAAGTTCATCT Agt angiotensinogen NM_007428 114 1332-1445 AAAGCAGGAGAGGAGGAACA TGAGTCCTGCTCGTAGATGG Ak1 adenylate kinase 1 NM_021515 162 212-373 CACCTGTCTACTGGGGACCT GCCATTGGAAGAATCCACTT Ak1 adenylate kinase 1 NM_021515 189 1680-1870 GGAGTGTGAGCTGCCATAGA GGGAAGTCACTAGGGATGGA Akap6 A kinase (PRKA) anchor protein 6 NM_198111 217 4332-4548 GGGAGTGCATTAAGCTTTCA CTCTGCGGCTGTTTCATTAT AKAP7 A kinase (PRKA) anchor protein 7 NM_018747 ATCGACCACAGATTTGGAGA CTCCACCAGCCTCTTACTGA AKAP7 A kinase (PRKA) anchor protein 7 NM_018747 165 GATCTCTGCTCCATGCTGAA GTACTGCTGGACAGCCTTGA AKAP7 A kinase (PRKA) anchor protein 7 NM_018747 216 2605-2820 TTTTGCTGAGCGTTTGAATG AGAACACAGCCTTGGGCTTA AKAP7 A kinase (PRKA) anchor protein 7 NM_018747 231 1007-1237 GGCTCAGTAAGAGGCTGGTG CAGGGCTTGAACAAGACACA Akt1 thymoma viral proto-oncogene 1 NM_009652 183 1137-1319 GACGGGCACATCAAGATAAC GCCACACATCATCTCGTACA Akt1s1 AKT1 substrate 1 NM_026270 150 733-882 CGATCGTCAGATGAGGAGAA CTGGAAGTCGCTGGTATTGA Akt1s1 AKT1 substrate 1 NM_026270 247 660-906 TACCCAGCAGTATGCCAAGT CGCTTAATATTTCCGCTTCA Akt1s1 AKT1 substrate 1 NM_026270 160 1006-1165 TAAACGCTCCAAGGGTCAAC GGTAGGGGAACTCTGGAAGG Akt1s1 AKT1 substrate 1 NM_026270 203 1147-1349 CTTCCAGAGTTCCCCTACCC ACCAGAGAGGGACCCAGACT Akt1s1 AKT1 substrate 1 NM_026270 217 198-414 CACTGGCACAGAGCTGGTAT AGGTGGTGGACTAGGAGCAG Akt2 thymoma viral proto-oncogene 2 NM_001110208 209 2232-2440 CTGTCCTCTGGGCAATCTTA CGAACATTCCTCCTGCTTTA Ambra1 autophagy/beclin 1 regulator 1 NM_172669 181 2653-2833 CAACCAGGGTCCATCAGTAG TTCATGAAAAATCCCAGCAT Ambra1 autophagy/beclin 1 regulator 1 NM_172669 176 1733-1908 GGCTCTCAGGCATCTGTGTA TCCTGCAGCCTGTCATACTC Ambra1 autophagy/beclin 1 regulator 1 NM_172669 111 267-377 GACCTGAATGGCCTCATTTT CTGGGACAACTTTCATGGTG Anapc2 anaphase promoting complex subunit 2 NM_175300 152 960-1111 CTTGGCAAAGTGTTCCTTCA TCTCGGATGATGCTGAAAAG Anapc2 anaphase promoting complex subunit 2 NM_175300 185 2362-2546 GCCTCTCTCTGGAGCGTATC CCTGGAAAGGGAACATCAGT Anapc2 anaphase promoting complex subunit 2 NM_175300 182 1270-1451 CCATCAAGGCATTACGTGTG GCAGGCAGGGTCAGTCTTAG Anapc2 anaphase promoting complex subunit 2 NM_175300 201 2719-2919 CCTCTATAGCCACCCAACCA ACTCTGAGCTGCCAACCCTA Anapc4 anaphase promoting complex subunit 4 NM_024213 159 1592-1750 CACCCCCTAACACAGAAGGA CTGGCTTTTGCAAACACTGA Ang angiogenin, ribonuclease, RNase A family, 5 NM_007447 174 142-315 CACTCTGGCTCAGGATGACT GCCTTGATGTTGCTCTTGTT Ang angiogenin, ribonuclease, RNase A family, 5 NM_007447 203 71-273 TTGGAAGAGATGGCGATAAG TCTTTGCAGGGTGAGGTTAG Ang angiogenin, ribonuclease, RNase A family, 5 NM_007447 216 263-478 CCCTGCAAAGATGTCAACAC GCCATTCTCACAGGCAATAA Ang4 angiogenin, ribonuclease A family, member 4 NM_177544 186 144-329 TGGTTGTGATTCCTCCAACT CCCTGATGTTTTTCTTGGTG Ang4 angiogenin, ribonuclease A family, member 4 NM_177544 160 381-540 ATTCTCCCTTCCAGATCACC CCTGCTGTCTACGGACTGAT Ang4 angiogenin, ribonuclease A family, member 4 NM_177544 204 199-402 TCAGCACTATGATGCCAAGC GTGGTGATCTGGAAGGGAGA Anxa1 Annexin A1 NM_010730 158 414-571 ACTCCAGCTCAGTTTGATGC TTGGCCAGATCTCTTTTCAG Anxa10 Annexin A10 NM_011922 219 258-476 TGGGACCTATCAGAGCATGT TCTCGCATCTGGAAAATCTC Anxa11 Annexin A11 NM_013469 233 1700-1932 CAAAGAGCACACTTCGGTTT AAGCAACAAGGAGTGAGTGC Anxa11 Annexin A11 NM_013469 179 313-491 TGTCTGGAACATTTGGAGGA ATATGAAGGCATCCCAGGAG Anxa11 Annexin A11 NM_013469 244 696-939 AACCGAGGTACCATCACTGC TCATCAGGGCCAGGATAGTC Anxa11 Annexin A11 NM_013469 125 239-363 TATCGGGCTGGATAACGTAG GAGCCCCAGGATACAGATTT Anxa11 Annexin A11 NM_013469 190 GCACACTTCGGTTTCCCTAT ACATCTGATCTGCCAGCAAG Anxa11 Annexin A11 NM_013469 141 AAACTCTGGAGGAGGCCATT CTGCATACAGCTCCTGGACA Anxa13 Annexin A13 NM_027211 199 1182-1380 GGCTTAGCAGGAACCTGAAC TTGTCTTTACGCCGCATTAG Anxa2 Annexin A2 NM_007585 157 165-321 ACCAACTTCGATGCTGAGAG GCTCCTTTTTGGTCCTTCTC Anxa3 Annexin A3 NM_013470 193 205-397 CCTCTATCTGGGTTGGACCT TGTTCATACGCTGCTTGGTA Anxa4 Annexin A4 NM_013471 239 657-895 CGAGGTGAAATTCCTAAGCA TGAGGGTGTTGTCATCAGTG Anxa5 Annexin A5 NM_009673 200 412-611 ACGACTCTACGATGCCTACG CCACCAACATCCTCTGGTAG Anxa5 Annexin A5 NM_009673 217 613-829 CCTCCTTCAGGCGAATAGAG TCGATCAATGGTTTCCTCAA Anxa6 Annexin A6 NM_013472 190 139-328 GTTTGACGCAAATCAGGATG GAACTTCCCCGTCAACTCAT Anxa7 Annexin A7 NM_009674 246 645-890 AAGACCATGTATGGCAAGGA CTTCTCAAGGTCTCGTCCAA Anxa8 Annexin A8 NM_013473 245 536-780 GGATTCTGGTGTGTCTCCTG ACCATGGGTCTCACTCTTGA Anxa9 Annexin A9 NM_001085383 183 353-535 GAGCAGAGAGCAAAGACAGC GCAGAACCAGAGGTCTTCAA Apaf1 apoptotic peptidase activating factor 1 NM_001042558 214 3753-3966 GTATGGAATTGGCAGACAGG ACTTGGTCGCATCAGAAGAG Apoa1 apolipoprotein A-I NM_009692 165 285-449 GTCCCAGTTTGAATCCTCCT TCCTGTCTCACCCAATCTGT Apoa1 apolipoprotein A-I NM_009692 170 246-415 GTATGTGGATGCGGTCAAAG TATCCCAGAAGTCCCGAGTC Apoa1 apolipoprotein A-I NM_009692 196 340-535 AACTGGGACACTCTGGGTTC GCTCCACATCCTCTTTCCAT Apoa2 apolipoprotein A-II NM_013474 161 48-208 AAGGACTGCAGCACAGAATC ATTGAGTGAACAGGCTCTGC Apoa5 apolipoprotein A-V NM_080434 216 820-1035 AAGATGGAGATTCCCTGGAC TGCTCAGGGCCTTATTACTG Apoa5 apolipoprotein A-V NM_080434 216 820-1035 AAGATGGAGATTCCCTGGAC TGCTCAGGGCCTTATTACTG Apoa5 apolipoprotein A-V NM_080434 184 1163-1346 AGCCGCTAGCATGGTCTATT TCCTGTCACCTCACTCTTGC Apoa5 apolipoprotein A-V NM_080434 163 392-554 GCAGCAGTTGAAACCCTACA CACTCGACTCTGCATGTCCT Apoa5 apolipoprotein A-V NM_080434 239 899-1137 CCTGCAGATTGCTGCATTTA GTTAACCGGAGTGACCCTCA Apob apolipoprotein B NM_009693 226 7672-7897 AGGGAACTGGAGCACTTCTT GGAGACTGACCTCAAAAGCA Apoc1 apolipoprotein C-I NM_007469 241 223-463 GAACATTGGAGAGCATACCG CTGTGATGAAGAGGGACCTG Apoc2 apolipoprotein C-II NM_009695 180 183-362 TTCCTGGTCATCCTGATGTT CCTGAGTTTCTCATCCATGC Apoc3 apolipoprotein C-III NM_023114 243 234-476 GCTGGATGGACAATCACTTC GATCTAGGGAGGGGTGAAGA Apod apolipoprotein D NM_007470 195 850-1044 GAGGGGACTCATGGAAAGTT TGGCCATCAGCTTTCTCTAC Apoe apolipoprotein E NM_009696 200 68-267 GGACAGGGGGAGTCCTATAA ACTCGAGCTGATCTGTCACC Apol8 apolipoprotein L 8 BC129972 192 1311-1502 CTCCCAGAGCTGGAGTTACA CCCATTCTTTTCCCTTCACT Ar androgen receptor NM_013476 242 1231-1472 GCTATGGGGACTTGGGTAGT TTCGGAGGCAGAGTAGTCAC Ar androgen receptor NM_013476 198 1663-1860 ATGAAGCTTCTGGCTGTCAC TACGAGCTCCCAGAGTCATC Ar androgen receptor NM_013476 171 1601-1771 GGACCATGTTTTACCCATCG TCGTTTCTGCTGGCACATAG Ar androgen receptor NM_013476 179 615-793 GTAATCTCCGAAGGCAGCAG TCCCCTGGACTCAGATGTTC Areg amphiregulin NM_009704 218 359-576 GGAAGAGAGGTTTCCACCAT TTTTTGCCTCCCTTTTTCTT Areg amphiregulin NM_009704 243 714-956 aacggtgtggagaaaaatcc ttgtcctcagctaggcaatg Areg amphiregulin NM_009704 170 340-509 tggacttgagctttctgtgg tgggcttaatcacctgttca Areg amphiregulin NM_009704 300 394-693 tggcagtgaactctccacag caattgcatgtcaccacctc Arnt aryl hydrocarbon receptor nuclear translocator NM_001037737 236 3648-3883 AGGTCTGCTGAAGTCTGGTG TGACAGGAGCCAGTTTAAGG Arnt aryl hydrocarbon receptor nuclear translocator NM_001037737 222 1272-1493 TGTAGACCATCGTTGTGTGG GGGTTTTGGAAGGTAAAGGA Arnt aryl hydrocarbon receptor nuclear translocator NM_001037737 192 2210-2401 CTGCCTCATCTGGTACTGCT CTTGTGTCTGCTGAACATGC Arrb1 arrestin, beta 1 NM_177231 158 5071-5228 AGTGAGGAAAACTGGGCTCT AAAGGTCTCCAAGGAGCTGT Arrb1 arrestin, beta 1 NM_177231 195 3268-3462 CTACATAGCCGCGAATGACT TAGGAGGTTCAGAGCAGTGG Arrb1 arrestin, beta 1 NM_177231 195 778-972 ACTCTGTGCGGCTAGTCATC TCTTGTTGGTGTTGTTGGTG Arrb2 arrestin, beta 2 NM_145429 186 1297-1482 GACCAGTTTTGCTAGGACGA AGCGAGCTGAAGTCAGAAGA Arrb2 arrestin, beta 2 NM_145429 206 856-1061 CAAGATGACCAGGTGTCTCC TTCACCTTGACCCTGTAGGA Arrb2 arrestin, beta 2 NM_145429 162 379-540 CTACAGGACCGACTGCTGAA TGATTTGGCACAGAAAGCTC Atf1 activating transcription factor 1 NM_007497 162 1161-1322 ACAGACATGATGGAGGGAGA AACGGACTGCTTCACTAACG Atf1 activating transcription factor 1 NM_007497 151 800-950 GACCGTGGTGATGACTTCTC CTCCAGGCACTTCACGTACT Atf1 activating transcription factor 1 NM_007497 200 366-565 GACAGCATAGGCTCCTCACA GCAATGGCAATGTACTGTCC Atf4 activating transcription factor 4 NM_009716 241 727-967 AAACCTCATGGGTTCTCCAG GAGGGGCAAAAAGATCACAT Atf4 activating transcription factor 4 NM_009716 209 1464-1672 CACTAGGTACCGCCAGAAGA TACAAGCACAAAGCACCTGA Atg10 autophagy-related 10 NM_025770 170 827-996 GACATCTGCAGAAGCCTGTT CTCCACAGCAGGAGAACTGT Atg10 autophagy-related 10 NM_025770 210 214-423 GAGACCTTGACACCACATGC CTCCAGAGCTAACGGTCTCC Atg10 autophagy-related 10 NM_025770 252 502-753 CATCCAATACTTGGGCAACC TCTTGGCATTCTTCATGCTG Atg10 autophagy-related 10 NM_025770 218 734-951 CAGCATGAAGAATGCCAAGA GCCCTGATGACGTCAGAAAT Atg10 autophagy-related 10 NM_025770 187 123-309 TTCACAGCAGATAGGCGATG TGCAGGTCTCGTCACTTCAG Atg10 autophagy-related 10 NM_025770 165 977-1141 ACAGTTCTCCTGCTGTGGAG CCATTGCTCCTGAATTTGAC Atg12 autophagy-related 12 NM_026217 146 1081-1226 AATCATGCAGGGACACAGTT CACTCTTCCTGCTCAGGTGT Atg12 autophagy-related 12 NM_026217 279 243-521 AACAAAGAAATGGGCTGTGG CAGCACCGAAATGTCTCTGA Atg12 autophagy-related 12 NM_026217 191 664-854 TGCCATTACTCCCACACACT GGTCCCCTGAATAAGCAAAA Atg16l1 autophagy-related 16-like 1 NM_029846 105 2444-2548 TGTCTGGTCTCACTGCTGAA CCTTTCCTCACACACACACA Atg16l1 autophagy-related 16-like 1 NM_029846 211 1164-1374 GGTGAAACTTTGGGAAGCAT CTTGGCAGAGAGGACTTTCC Atg16l1 autophagy-related 16-like 1 NM_029846 118 1911-2028 TGTGGACAAAGGAAGCAGAG CAGCTCTTTTCTGGGAGGAC Atg16l1 autophagy-related 16-like 1 NM_029846 236 470-705 ACAACCAAATGCAGCAGAAG GGTGACCAGTTCCTGGTTCT Atg16l1 autophagy-related 16-like 1 NM_029846 227 398-624 TCAAACACCAGGAAGAGCTG CTCATCCTTCAGGGTCTGGT Atg16l1 autophagy-related 16-like 1 NM_029846 235 1355-1589 GGAAAGTCCTCTCTGCCAAG AGTTCCATCTCTCGGACCAC Atg16l2 autophagy related 16 like 2 NM_001111111 293 1674-1966 GCAATATCCGACAGGTGTTC CAGAGTCCAACCCATACAGG Atg16l2 autophagy related 16 like 2 NM_001111111 192 1717-1908 TTCTGACTGGACCAAAGCTG CCTTGGTCCACACTCACAAC Atg16l2 autophagy related 16 like 2 NM_001111111 299 736-1034 GTCCCAGGAGCTGAAGAAAG ACACACACACAGGGATGCTT Atg16l2 autophagy related 16 like 2 NM_001111111 170 1347-1516 TGACTGCTGCCAAATTCAAG ATTGTGGCCACTGATGATGA Atg16l2 autophagy related 16 like 2 NM_001111111 235 180-414 TGCCGGCTTATAACCATCTC TTCTTCACCACCTGGTAGGC Atg16l2 autophagy related 16 like 2 NM_001111111 217 1398-1614 GAGACCGGACAGTGAAGGAG TGGTCATAGCTGAGGTGCAG Atg16l2 autophagy related 16 like 2 NM_001111111 186 1432-1617 CGCCTACTGTTCCAGGACTA AGCTGGTCATAGCTGAGGTG Atg16l2 autophagy related 16 like 2 NM_001111111 214 1150-1363 GATCCACCTCTGGAATGTTG GAATTTGGCAGCAGTCACTT Atg16l2 autophagy related 16 like 2 NM_001111111 218 951-1168 GGCTGTTGGACTTCAAGAAA AACATTCCAGAGGTGGATCA Atg2a ATG2 autophagy related 2 homolog A NM_194348 167 5613-5779 AAGGCTTATGATGCTGTTCG GTTGCCTCTGTTGCTACGAT Atg2a ATG2 autophagy related 2 homolog A NM_194348 230 5799-6088 ATGCGTAACCAGATCCTTCC GGGCAGGTATCCTTCACAGT Atg2a ATG2 autophagy related 2 homolog A NM_194348 206 4866-5071 ACCAGCCTAGCAGCCAGTAT TCAGATGTGAAGCGGAACTC Atg2b ATG2 autophagy related 2 homolog B NM_029654 227 4697-4923 GACCACAGGCTAATGGTGTC TTCCTTCTCCTGAACGACTG Atg2b ATG2 autophagy related 2 homolog B NM_029654 260 1201-1460 TATGAGCCACACCCACAACT TTAGCCAGCCCTATTTTGCT Atg2b ATG2 autophagy related 2 homolog B NM_029654 297 7838-8134 TGTGCGTGAGAAAGGAAGTC AGACATGGGCTCCACCTAAC Atg3 autophagy-related 3 NM_026402 181 1569-1749 CCCTACATCTGCTCTGTGCT CCCCTTCAAGTCCCACTATT Atg3 autophagy-related 3 NM_026402 124 1433-1556 GTAGGGTTTCCCCTGTCAGA TGGGAATGGAGTAGGGAGAG Atg3 autophagy-related 3 NM_026402 116 583-698 TGGGGGATGGGTAGATACAT ACAGTGCTGAGCAATCTTGG Atg4a autophagy-related 4A NM_174875 154 796-949 TTAGGGGCTTTAGGAGGAAA ACTGCAGGCAATGAAAAGTC Atg4a autophagy-related 4A NM_174875 233 108-340 ATTCCCGGATACAGATGAGC AATCCCTTCCCAAGTGTCTG Atg4a autophagy-related 4A NM_174875 287 873-1159 CCCTCACACAACCCAGACTT CCCCTGTGGTTGTCACTTCT Atg4b autophagy-related 4B NM_174874 152 2167-2318 TCTGGGTCACAGGAAATTGT GGCAGGTATGGAAATGAGTG Atg4c autophagy-related 4C NM_175029 218 341-558 AGTGGAGAAGGTTGGAGCTT GCCATCACTTGATTCCATTC Atg4c autophagy-related 4C NM_175029 192 790-981 TAATTGCAGGGAATGTGGAA AGGTCCAAGCTCTACCGAGA Atg4c autophagy-related 4C NM_175029 249 1006-1254 ACGCAGACTCTGACTCATGG TCCCAGACTTCTTCCCAAAC Atg4d autophagy-related 4D NM_153583 150 1427-1576 ATCCTCAGCTCCTCCTCAGT TTTGGCCTTGAGTAGTCGTC Atg5 autophagy-related 5 NM_053069 207 1187-1393 AAGTTCAGTGGAGGCAACAG ACTGTGGCACATTTCCATTT Atg7 autophagy-related 7 NM_028835 173 228-400 CGTTGGAGTTCAGTGCTTTT AGCAGCACCTGACTTTATGG Atg9a autophagy-related 9A NM_001003917 215 501-715 AGCCTGTCAAGGTCACTCTG GTATGGAAGGGCAGACATTG Atg9a autophagy-related 9A NM_001003917 207 613-819 GATCCACCGGCTTATCAAGT ATGCGATGGTAGATGTCCAA Atg9a autophagy-related 9A NM_001003917 235 291-525 CTTGGCACCACATTGAAAAC TCTGGCAGAGTGACCTTGAC Atg9b ATG9 autophagy related 9 homolog B NM_001002897 199 951-1149 AACAACCAACCAAAGAACCA TGTCCCAGTAGCTGAAGAGG Atg9b ATG9 autophagy related 9 homolog B NM_001002897 161 2130-2290 CTCCTGACCCCATTGTTTCT TCTGAAAGCCACTGAGGATG Atg9b ATG9 autophagy related 9 homolog B NM_001002897 227 470-696 GGCTTCTCAGACTCCACACA CACAGTCCTCTAGCCGTTCA Atg9b ATG9 autophagy related 9 homolog B NM_001002897 193 3394-3586 GGGTGAGTGGAAAAACCAGA TGAACAGGTGCAGTCCTCAG Atg9b ATG9 autophagy related 9 homolog B NM_001002897 197 879-1075 CTGGGGCAGTTCATTTTCAT AGGAAGACCAACAGGGGACT Atg9b ATG9 autophagy related 9 homolog B NM_001002897 183 2719-2901 TGAGCCTCCACGCTATTTAC GTTGTCTTGGGCTAGAAGCA Atm ataxia telangiectasia mutated homolog NM_007499 207 2668-2874 TGGTTGTGACAGTCTGATGG GCAGTTACAGATCGGCCTAA Atr ataxia telangiectasia and Rad3 related NM_019864 187 3803-3987 GCAGCCTAAAGAAACTGCTG GCTGGAGAGTGGTTTGAAGA Atr ataxia telangiectasia and Rad3 related NM_019864 217 4156-4372 GCCAAGATGCAAACTCTCAA TCTTGTGCTCGGCTGTTATC Atr ataxia telangiectasia and Rad3 related NM_019864 150 7411-7560 GGCATCCTCCTGTTTTTCAT TGTTTTCACCATGACGGTCT Atr ataxia telangiectasia and Rad3 related NM_019864 134 5052-5185 GCTGTAGCGTCCTTTCGTTC GGCTCATGCATAGCAGCATA Axin2 axin2 NM_015732 192 508-699 TAATGCTAGGCGGAATGAAG AACCCATTACAAGCAAACCA Axin2 axin2 NM_015732 186 656-841 AAATGTGTGGATACGCTGGA TTGCTTCTTGATGCCATCTC Axin2 axin2 NM_015732 234 958-1191 GGGGGAAAACACAGCTTACA TTGACTGGGTCGCTTCTCTT B2m beta-2 microglobulin NM_009735 198 GGCCTGTATGCTATCCAGAA GAAAGACCAGTCCTTGCTGA Bad Bcl-associated death promoter NM_007522 257 1148-1404 AGTCTTTCGAGGCCTTAGGA CCCCAGTTATGACAGGACAG Bag1 Bcl2-associated athanogene 1 NM_009736 173 370-542 GAAAGTGACCCGTAGCAAGA TGAGTCTGGGTGTTTCCATT Bag3 Bcl2-associated athanogene 3 NM_013863 228 1728-1955 ACAAACTGAAAGCCAACAGC GCCCCCTTTGTTAGTGTTTT Bag4 BCL2-associated athanogene 4 NM_026121 266 3528-3793 AGGTTTTCGAAGCTGGATTT GGGCAGCGTAAGTGAAGTAA Bag4 BCL2-associated athanogene 4 NM_026121 154 2428-2581 AGCCGTAGCTGAAGTGGAAA GGCCCCTTTCTTAAACTTGG Bag4 BCL2-associated athanogene 4 NM_026121 162 3808-3969 tgcacatccttcattggtgt aaaacaaggggaaggcagat Bag4 BCL2-associated athanogene 4 NM_026121 168 1267-1434 ggcttctggaagaaatgctg ctcccctgcattccaagtta Bak1 BCL2-antagonist/killer 1 NM_007523 163 566-728 GCCTACGAACTCTTCACCAA TATCAGCCAAAAAGCAGGTC Barkor Barkor BC090995 243 3138-3380 CCGAAAGCCATAGAAGTTGA TGTGTGATCAACCTGACCTG Barkor Barkor BC090995 166 2086-2251 AGCGTTGGCTGAACACTTAC TGCATAAGGTGCTGTCTTCA Barkor Barkor BC090995 164 2549-2712 TTGACTCACACTGTGGTTGG TGAGCACAGAACAGACTCCA Bax Bcl2-associated X protein NM_007527 194 675-868 GCTCACCATCTGGAAGAAGA ACAATCCAAAGTGGACCTGA Bax Bcl2-associated X protein NM_007527 173 350-522 TGCAGAGGATGATTGCTGAC GATCAGCTCGGGCACTTTAG Bax Bcl2-associated X protein NM_007527 246 339-584 caatatggagctgcagagga tcttggatccagacaagcag Bax Bcl2-associated X protein NM_007527 174 474-647 tagcaaactggtgctcaagg atggtcactgtctgccatgt Bax Bcl2-associated X protein NM_007527 156 199-354 ttgctacagggtttcatcca ctgcagctccatattgctgt Bbc3 Bcl-2 binding component 3 NM_133234 284 992-1275 GGGTGCACTGATGGAGATAC TGGCTCATATGCTCTTCACA Bbc3 Bcl-2 binding component 3 NM_133234 191 537-727 GCCCAGCAGCACTTAGAGTC TGTCGATGCTGCTCTTCTTG Bbc3 Bcl-2 binding component 3 NM_133234 191 592-782 gcccagcagcacttagagtc tgtcgatgctgctcttcttg Bbc3 Bcl-2 binding component 3 NM_133234 196 1304-1499 gggggtctgtgaagagcata gcagagcacaggattcacag bbox1 butyrobetaine (gamma), 2-oxoglutarate dioxygenase 1 NM_130452 161 845-1005 TTCTCTCCTCGACCTTTGTG GATGGGGACATCAAAGACTG bbox1 butyrobetaine (gamma), 2-oxoglutarate dioxygenase 1 NM_130452 227 290-516 ATTTGACATTTGACCGGAAA AAGCCATTTGTATGCATGGT bbox1 butyrobetaine (gamma), 2-oxoglutarate dioxygenase 1 NM_130452 178 687-864 GCTCAGCTTCCACACTGACT CACAAAGGTCGAGGAGAGAA Bccip BRCA2 and CDKN1A interacting protein NM_025392 205 303-507 AGCTGACGAATCTCCTGATG TGCTCACAGGTCTTCTCACA Bccip BRCA2 and CDKN1A interacting protein NM_025392 167 581-747 TTCATTAACGTCCCTCCACA TCCTGCCTCTTTCTGGAACT Bccip BRCA2 and CDKN1A interacting protein NM_025392 157 728-884 AGTTCCAGAAAGAGGCAGGA CATCATCGAAGGACCATCTG Bccip BRCA2 and CDKN1A interacting protein NM_025392 206 119-324 GATGAGGTGGAGGATGAGGA TGCATCAGGAGATTCGTCAG Bcl10 B-cell leukemia/lymphoma 10 NM_009740 187 574-760 TTCTTCTCTATGGCGTCGTC ACCGTAAGGGGAGAAACATC Bcl2 B-cell leukemia/lymphoma 2 NM_177410 250 708-957 CTGGAAACCCTCCTGATTTT AAATATTTCAAACGCGTCCA Bcl2 B-cell leukemia/lymphoma 2 NM_177410 154 1707-1860 TGACTTCTCTCGTCGCTACC GAACTCAAAGAAGGCCACAA Bcl2 B-cell leukemia/lymphoma 2 NM_177410 197 513-709 AGCGTGTGTGTGCAAGTGTA AGATTGGGTCCTCACACTCC Bcl2 B-cell leukemia/lymphoma 2 NM_177410 205 1366-1570 GGACTTGAAGTGCCATTGGT CAGGCTGGAAGGAGAAGATG Bcl2a1d B-cell leukemia/lymphoma 2 related protein A1d NM_007536 245 383-627 TAACTGGGGAAGGATTGTGA CCCAGATCTGTCCTGTCATC Bcl2l1 Bcl2-like 1 NM_009743 175 518-692 CATCCCAGCTTCACATAACC GCAATCCGACTCACCAATAC Bcl2l11 BCL2-like 11 NM_207680 179 2005-2183 GAGTTAGGGGCTGGCTCTAC GACCAAGAAAGAGCACCTCA Bcl2l2 Bcl2-like 2 NM_007537 213 2695-2907 GGGAAGTCTCTGCTCTACCC CCACTGTGGTCCCATCTAAG Bcl2l2 Bcl2-like 2 NM_007537 229 2186-2414 GACCCACCTCTTCACTTGGT TCCCACTCTGACTGCTTGTC Bcl2l2 Bcl2-like 2 NM_007537 163 537-699 GACAAGTGCAGGATTGGATG AGCACTGTCCTCACTGATGC Bcl2l2 Bcl2-like 2 NM_007537 181 2540-2720 gccctcaaacagaacagctc tgggaagggtagagcagaga Bcl2l2 Bcl2-like 2 NM_007537 210 2774-2983 caggaaccagggtcaggtta cctggttttccctgacagaa Bcl3 B-cell leukemia/lymphoma 3 NM_033601 197 1501-1697 TGAGGACCTTGTTCTGCTTC TTTGGTTCCTCCACTCAAAG Bcl6 B-cell CLL/lymphoma 6 (zinc finger protein 51) NM_009744 153 375-527 ACCTGAGGGAAGGCAATATC GGCTGTTCAGGAACTCTTCA Becn1 beclin 1, autophagy related NM_019584 200 622-821 CGCTGTTTGGAGATCCTAGA TGGTACTGAGCTTCCTCCTG BECN1L1 Bfar bifunctional apoptosis regulator NM_025976 210 2046-2255 TCTACAACAGCCAGGGCTAC TTGACTCATGGGACAGACCT Bfar bifunctional apoptosis regulator NM_025976 188 2004-2191 GGCAGGTGGATTTTTGAGTT CTGACCATAATGGCCTTCCT Bfar bifunctional apoptosis regulator NM_025976 152 2452-2603 TTCTCCTTCTGTGAGCATGG AGGGCAGCTTACAAAATGCT Bfar bifunctional apoptosis regulator NM_025976 179 1618-1796 ggctggaaacccaagtgtta ggtgccagagtcagaggaag Bfar bifunctional apoptosis regulator NM_025976 212 1076-1287 caacccgggtagatccctat cgaggaattctctccactgc Bik Bcl2-interacting killer NM_007546 251 175-425 TGAAGGAGCCTGTGAGAGAC CAAGACTCTCCAGGACCAGA Bik Bcl2-interacting killer NM_007546 154 257-410 CGATGAGATGGACCTGTGTC CCAGATGTTTTCCCTGAGGT Bik Bcl2-interacting killer NM_007546 189 584-772 GGCACCCTAACTGAGGTGTT GCAGGGGTCAAGAGAAGAAG Bik Bcl2-interacting killer NM_007546 196 1304-1499 gggggtctgtgaagagcata gcagagcacaggattcacag Bik Bcl2-interacting killer NM_007546 236 763-998 caagaagagcagcatcgaca aaggctggcagtccagtatg Birc2 baculoviral IAP repeat-containing 2 NM_007465 232 2836-3067 TGCTTGCTGTATGTCCTTCA GATGCACGCCTTTAAAAGAA Birc3 baculoviral IAP repeat-containing 3 NM_007464 159 1799-1957 TTTCCAACATTTGACGTGTG GTTGCTGCAGTGTTTCCTTT Birc5 baculoviral IAP repeat-containing 5 NM_009689 152 711-862 GGTTTTGTGGCTTTGCTCTA CTGCATTAGCAGCCCTGTAT Birc6 baculoviral IAP repeat-containing 6 NM_007566 196 9275-9470 TGCAAGTGGCTTACATCTCA CTGGCAAGTAGCAAGAGAGC Blk B lymphoid kinase NM_007549 153 2094-2246 ATGAGCTCTCAAGGCACAAC ACTATCGGGGTCTGAACACA Bmp2 bone morphogenetic protein 2 NM_007553 TCTTTGCACCAAGATGAACA CCACATCACTGAAGTCCACA Bmp2 bone morphogenetic protein 2 NM_007553 229 908-1138 CAAGATGAACACAGCTGGTC TCCCCATGGCAGTAAAAGGC Bmp2 bone morphogenetic protein 2 NM_007553 CTCCACAAACGAGAAAAGCG CATGCCTTAGGGATTTTGGA Bmp2 bone morphogenetic protein 2 NM_007553 CCAGGTGTCTCCAAGAGACA TGACGCTTTTCTCGTTTGTG Bmp2 bone morphogenetic protein 2 NM_007553 243 ATATGGGTTCAACTCCAGCA AACAGACAGCAAGTGTGCAA Bmp2 bone morphogenetic protein 2 NM_007553 157 1821-1977 TTGCACACTTGCTGTCTGTT GTTCTCACGGATTGGACAAC Bmp2 bone morphogenetic protein 2 NM_007553 156 924-1079 GGTCACAGATAAGGCCATTG CCACATCACTGAAGTCCACA Bmp4 bone morphogenetic protein 4 NM_007554 AGCCTTTCCAGCAAGTTTGT TCTTCCCGGTCTCAGGTATC Bmp4 bone morphogenetic protein 4 NM_007554 207 830-1038 TGAGAGCTCTGCTTTTCGTT TGGTGTCCAGTAGTCGTGTG Bmp4 bone morphogenetic protein 4 NM_007554 Bnip3 BCL2/adenovirus E1B interacting protein 1 NM_009760 204 1276-1479 TTGCTGTCCACCATTACCTT GCAGCTTTGGATCCTGATTA Bnip3l BCL2/adenovirus E1B interacting protein 3-like NM_009761 160 2527-2686 AAAGCCGAAATCAAATGGTC GCACTGTCGATGAAACTGCT Bnip3l BCL2/adenovirus E1B interacting protein 3-like NM_009761 168 780-947 TGGCCTGTGAAGTGGTGTAT TTACAGGCCAAAAAGGGAAC Bnip3l BCL2/adenovirus E1B interacting protein 3-like NM_009761 219 1784-2002 TCTGGAAAGATGCCATTCAT GATAATCCGCAATCCTGATG Bok Bcl-2-related ovarian killer protein NM_016778 166 1051-1216 GAACTCCTGCCAGAAAGTCA TCCCCTTCAGGTCAAATGTA Brca1 breast cancer 1 NM_009764 178 5522-5699 ACGTCTTGTGATGTGGGACT GGAAGCACCAAAGACTGAGA Brca1 breast cancer 1 NM_009764 151 1614-1764 CACCTGAACCATGTGACTGA GAACACCTGCTGAATCTGCT Brca1 breast cancer 1 NM_009764 155 6239-6393 AGTGCCAGTGTCAAGGAGAG ACTCCTTTCCTGGTGGAATC Brca1 breast cancer 1 NM_009764 197 3835-4031 CACAGCGTATGCCAGAGAAA ATCCTGGGAGTTTGCATTTG Brca2 breast cancer 2 NM_001081001 213 10038-10250 ACGAGATTGATGACCCAAAA TCTTCTGAAATGGCGTTCTC Brca2 breast cancer 2 NM_001081001 242 9289-9530 TGCAGTGTCAAAATCGAAGA AGACCAAAGGAGCAAGACCT Brca2 breast cancer 2 NM_001081001 227 7431-7657 GGAGACACTCAGCTTTGGAA CCTGTCTCCATCTGTGCTCT Brca2 breast cancer 2 NM_001081001 161 8253-8413 TTGACAACAGCAGGAGATCG GTCCACTTTGTTGGCATCCT Brd4 bromodomain containing 4 NM_020508 180 GAGTAAGGCCACCAACCAAA CTGAGGAGACGATCACACCA Brd4 bromodomain containing 4 NM_020508 182 GCCTTTCAGCACCTCACTTC GCTCCTGCTTCTGTTTGTCC Brd4 bromodomain containing 4 NM_020508 215 GGACGAGGGAGGAAAGAAAC GGAGTCTGAAGTGGCTGAGG Bre brain and reproductive organ-expressed protein NM_181279 243 478-720 GAACCCTTCAAACCCTGAGT GTGGGAATGTTGCTGAAATC Bre brain and reproductive organ-expressed protein NM_181279 230 821-1050 TACTTGTCACCCCGAATTGA TTTGTGAAGCCTTCTGCATC Bre brain and reproductive organ-expressed protein NM_181279 167 62-228 GAAATTGCCTTGAACCGAAT AGATCTGGCACACCATACCA Bre brain and reproductive organ-expressed protein NM_181279 233 1127-1359 cagcctacgctcacatttca tggactgagcagtctggttg Bre brain and reproductive organ-expressed protein NM_181279 209 396-604 cagagctgcctcctgatttc ttccaggagcgtctggtact Bsg basigin NM_009768 161 319-479 GATCCAGTGGTGGTTTGAAG CGTAAGTGCCTGTGTCCTCT Bsg basigin NM_009768 212 825-1036 GGATCAAGGTCGGAAAGAAA GCTGATGGTCAGCTGTGACT Bsg basigin NM_009768 197 1300-1496 CAAGAATGTACGCCAGAGGA CTTCCAGGTGGGTTTTCTGT Bsg basigin NM_009768 246 944-1189 ACTGGGGAAGAAGAGGCAAT AACCAACACCAGGACCTCAG Btbd12 BTB (POZ) domain containing 12 NM_177472 193 2881-3073 AAGTCATTTGTCCCCCTCAG CAGGATGCCCCTATTTCTGT Btbd12 BTB (POZ) domain containing 12 NM_177472 171 4215-4385 CTGTGGCTCAAATGCTGAGT GGACTCCAAACCTGTCCAGT Btg1 B-cell translocation gene 1, anti-proliferative NM_007569 151 481-631 AAACATCACTGGTTCCCAGA TGAGTTCACTTGGGAGAAGC Btg1 B-cell translocation gene 1, anti-proliferative NM_007569 203 3331-3533 CCTGTGAAGCCTGCAAGTAT AAATGACACAGCAGCAGACA Btg1 B-cell translocation gene 1, anti-proliferative NM_007569 173 2910-3082 AGGCGTCTCGGATAATATGG CCAGCCTGGGATATAATGCT C20orf74 RIKEN cDNA A230067G21 gene NM_001033348 243 8906-9148 CTGACTCTGCCAAATGCTGT GGGTGTCTCTGGGTGAGTTT C20orf74 RIKEN cDNA A230067G21 gene NM_001033348 157 5784-5940 CGCTGCTCAAGTCTTTTCTC TCTGTGCCTCTTTCTTCCAC C3 complement component 3 NM_009778 187 4249-4435 CCATGTTCCTTGAAATCTGC ATGAGGGTGTTCTTGTTGGA C3 complement component 3 NM_009778 193 2995-3188 CAGACCTTAGCGACCAAGTG TCCAGGTAGTGTACCGCAAT C3 complement component 3 NM_009778 260 TTCATAGACTGCTGCAACCA GACAAGCTCACTGCCAGAAT C3 complement component 3 NM_009778 164 618-781 GGCATTCCTGTCAAGAGAGA TCCTTCACCTCAAACTCTGC C4a Complement component 4A (Rodgers blood group) NM_011413 175 4939-5113 CTTCCGTCTCTTTGAGTCCA TCCCTTGTTGTCACTGGTTT C6orf64 RIKEN cDNA 1810063B07 gene XM_973341 218 1172-1389 AATGCTCTCAACCACTGAGC AAGGGGAAAATGAAAGATGG C6orf64 RIKEN cDNA 1810063B07 gene XM_973341 224 725-948 GACCTGCTGCAGTTTCATCT ATTTAAAAGGAGCCCCAATG C6orf64 RIKEN cDNA 1810063B07 gene XM_973341 224 1836-2059 CATTACCGATGGTTGTGAGC GAGTGCTCACCCAAAGCATA C6orf64 RIKEN cDNA 1810063B07 gene XM_973341 211 586-796 GAGCAGCTGGAGCAAGAGTT CCCACCCTGAGTGTCCTTTA C6orf64 RIKEN cDNA 1810063B07 gene XM_973341 239 1521-1899 GCAGCCTGCTCTTAACTGCT GATGCCCTCTTCTGGTGTGT Cacng calcium channel, voltage-dependent, gamma subunit 6 NM_133183 162 328-489 GGAGAAGCAAACTGCACCTA GAGCACCATGATGACACAGA Cacng calcium channel, voltage-dependent, gamma subunit 6 NM_133183 151 69-219 CCAAGAACAGCAGAATCTCG GCTGCCATTGGTCTTGTATG Calm calmodulin 1 NM_009790 151 1617-1767 GATTTCCCACCAGGTTCTCT CACCAGGGCTCTAGTCTGAA Calm calmodulin 1 NM_009790 231 253-483 CCATCACAACCAAGGAACTG CCGCACTGATGTAACCATTC Camp (Ll37) cathelicidin antimicrobial peptide NM_009921 160 143-302 TCAACCAGCAGTCCCTAGAC AAGGCACATTGCTCAGGTAG Camp (Ll37) cathelicidin antimicrobial peptide NM_009921 281 55-335 CGGTCACTATCACTGCTGCT CCCATACACTGCTTCACCAC Camp (Ll37) cathelicidin antimicrobial peptide NM_009921 128 127-254 CGAGCTGTGGATGACTTCAA TCCTTCACTCGGAACCTCAC Camp (Ll37) cathelicidin antimicrobial peptide NM_009921 Camp (Ll37) cathelicidin antimicrobial peptide NM_009921 Camp (Ll37) cathelicidin antimicrobial peptide NM_009921 Casp1 caspase 1 NM_009807 194 584-777 GACTGGGACCCTCAAGTTTT CCAGCAGCAACTTCATTTCT Casp14 caspase 14 NM_009809 173 1169-1341 ACGCCTTACTCTCCCTCCTA TCCTGCCTTGACTTCTTCAC Casp2 caspase 2 NM_007610 249 207-455 AAAAGAATCGAGTGGTGCTG CTGAGAGGGTTGTGAGCAGT Casp3 caspase 3 NM_009810 211 861-1071 GTCCATGCTCACGAAAGAAC ACCTGATGTCGAAGTTGAGG Casp3 caspase 3 NM_009810 283 AGCAAGTCAGTGGACTCTGG TCACACACACAAAGCTGCTC Casp3 caspase 3 NM_009810 170 275-444 cagccaacctcagagagaca aatgaccccttcatcaccat Casp3 caspase 3 NM_009810 204 518-721 ctggaaagccgaaactcttc aaagggactggatgaaccac Casp3 caspase 3 NM_009810 182 607-788 atggcttgccagaagatacc ttcctgttaacgcgagtgag Casp4 caspase 4, apoptosis-related cysteine peptidase NM_007609 163 1150-1312 TACCTCTTTCCTGGCAACTG GTTGCTTAGGCTGGTCTTGA Casp4 caspase 4, apoptosis-related cysteine peptidase NM_007609 159 958-1116 CCACATCACTTGTCCTACCG GGGCATCTGGGAATGAATAC Casp4 caspase 4, apoptosis-related cysteine peptidase NM_007609 230 355-584 AAGCTTTGTTCCCCTGAAGA CCCTCTGCTGTAAGCTCCTC Casp4 caspase 4, apoptosis-related cysteine peptidase NM_007609 185 37-221 aggctttttctcatggctga acaaaaacccaacgcttgtc Casp4 caspase 4, apoptosis-related cysteine peptidase NM_007609 150 185-334 acaatgctgaacgcagtgac ctggttcctccatttccaga Casp6 caspase 6 NM_009811 194 711-904 AATGGCTCCTGGTACATTCA AAATGCAGCTTTTTGGTCAG Casp7 caspase 7 NM_007611 171 859-1029 TCCACGGTTCCAGGTTATTA TGGATCATCAGACTGGGACT Casp8 caspase 8 NM_009812 170 1460-1629 TCTTTTTCATTCAGGCTTGC AACGCAGTTCTTCACCGTAG Casp8 caspase 8 NM_009812 190 470-660 GCTTGGACTACATCCCACAC TCTCTCACCATCTCCTCTCG Casp8ap2 caspase 8 associated protein 2 NM_011997 159 6088-3246 GTTTCAGAGAGGTTCCAGCA CATTTAAAACACGGGAATCG Casp9 caspase 9 NM_015733 162 1551-1712 GCAGATTCCTGGCTGTTTTA GCCCCAGTTCAAAATCCTAT Cbl Casitas B-lineage lymphoma NM_007619 208 2192-2399 TCTTCCTATGCCAAAACTGC TGCTTGGGACTGGATGTTAT Cbl Casitas B-lineage lymphoma NM_007619 189 4623-4811 AGGCTATTCGAAAGGCAGAT GATCATCTTGCCACCATCTC Cbl Casitas B-lineage lymphoma NM_007619 210 781-990 ATGAAGTGCATCCCATCAGT GCGCTTTCACTTCATCGTAT Cblb Casitas B-lineage lymphoma b NM_001033238 211 3203-3413 ACGTTTACTCCCCCTTGAAC CCGGATAGAGAGCAAAACAA Cblb Casitas B-lineage lymphoma b NM_001033238 169 3812-3980 ACCATAATGAGATGCCCTGA AGCCAGGGTGACATCATAAA Cblb Casitas B-lineage lymphoma b NM_001033238 245 1871-2115 TTCCACCATGGAGAGAGTGT GAAAAGACCTTGGCTCCTTC Ccbp2 chemokine binding protein 2 NM_021609 170 688-857 CATGAGCCTGGACAAATACC GCCACACACCATCTAAGGTC Ccbp2 chemokine binding protein 2 NM_021609 158 1507-1664 CCAGCAGGCCTTACTCATTA GAGTGGAGTGACCTCATTGG Ccbp2 chemokine binding protein 2 NM_021609 170 2247-2416 ACTTTCTGCCCTTGTGTGAG AGGATGTTTTAAGGGGATGC Ccbp2 chemokine binding protein 2 NM_021609 190 910-1099 CTTCCAGCTGAACCTTCTGG CGAGTGCAGAAACAAGGTGA Ccl1 Chemokine (C-C motif) ligand 1 NM_011329 175 147-321 TGCTTACGGTCTCCAATAGC TTTTGAACCCACGTTTTGTT Ccl1 chemokine (C-C motif) ligand 1 NM_011329 175 147-321 TGCTTACGGTCTCCAATAGC TTTTGAACCCACGTTTTGTT Ccl1 chemokine (C-C motif) ligand 1 NM_011329 110 290-399 TGCGCCTCAACTAACAAAAC ACTGCAGTCTCTGGTGCTG Ccl1 chemokine (C-C motif) ligand 1 NM_011329 132 163-294 TAGCTGCTGCTTGAACACCT GCGCAGCTTTCTCTACCTTT Ccl19 210 498-707 AGGAGCCCTGTGTCTTGAGT GGCTTTATTGGAAGCTCTGC Ccl19-5 174 126-299 ATTCTTGCGCACACAGTCTC CACAGACAGGCAGCAGTCTT Ccl19-6 212 281-485 AGACTGCTGCCTGTCTGTGA TGCTGTTGCCTTTGTTCTTG Ccl2 chemokine (C-C motif) ligand 2 NM_011333 219 AAGCCAGCTCTCTCTTCCTC TACAGCTTCTTTGGGACACC Ccl2 chemokine (C-C motif) ligand 2 NM_011333 182 AACCACCTCAAGCACTTCTG TGGATTCACAGAGAGGGAAA Ccl2 chemokine (C-C motif) ligand 2 NM_011333 249 AGGTCCCTGTCATGCTTCTG TCTGGACCCATTCCTTCTTG Ccl2 chemokine (C-C motif) ligand 2 NM_011333 210 CCCAATGAGTAGGCTGGAGA GCTGAAGACCTTAGGGCAGA Ccl2 chemokine (C-C motif) ligand 2 NM_011333 237 CAAGAAGGAATGGGTCCAGA AAGGCATCACAGTCCGAGTC Ccl2 chemokine (C-C motif) ligand 2 NM_011333 184 AGCACCAGCCAACTCTCACT TCATTGGGATCATCTTGCTG Ccl2 chemokine (C-C motif) ligand 2 NM_011333 170 227-446 AGTTTTTGTCACCAAGCTCA GGGTCAACTTCACATTCAAA Ccl2 chemokine (C-C motif) ligand 2 NM_011333 GGCTGGAGAGCTACAAGAGG ACGGGTCAACTTCACATTCA Ccl26 Chemokine (C-C motif) ligand 26 NM_001013412 166 2-167 TGTTCTTCGATTTGGGTCTC CAGCTCTTGTCGGTGAACTT Ccl26 chemokine (C-C motif) ligand 26 NM_001013412 133 35-167 CCATCTTCCTCAGTGTCCAG CAGCTCTTGTCGGTGAACTT Ccl26 chemokine (C-C motif) ligand 26 NM_001013412 134 148-281 AAGTTCACCGACAAGAGCTG CACAAATGGTTCCTGGTGTT Ccl26 chemokine (C-C motif) ligand 26 NM_001013412 154 23-176 TTGTTCTCCTGGCCATCTTC TCACTGGTGCAGCTCTTGTC Ccl9 chemokine (C-C motif) ligand 9 NM_011338 225 1264-1488 CACAGGTCTGTCTGCCTCTT CAGAGAAACCCTGTCTCGAA Ccl9 chemokine (C-C motif) ligand 9 NM_011338 244 851-1094 AGAGGACCTGGGTTCAATTC GTCCCACAGACCACTCTCAC Ccl9 chemokine (C-C motif) ligand 9 NM_011338 231 366-566 CAGATTGCTGCCTGTCCTAT TCACACCCTTCTCTTCAAGC Ccl9 chemokine (C-C motif) ligand 9 NM_011338 194 1080-1273 AGTGGTCTGTGGGACTTTGG CAGACCTGTGGCTGCATAGA Ccl9 chemokine (C-C motif) ligand 9 NM_011338 205 515-719 TCACAACCACGGACCTACAA GGGTTGGCACAGACAAGTTT Ccl9 chemokine (C-C motif) ligand 9 NM_011338 175 1327-1501 GGGAGAAAGCATCTCACTCG AGCCAGGGCTACACAGAGAA Ccl9 chemokine (C-C motif) ligand 9 NM_011338 221 308-528 ATGTTTCACATGGGCTTTCA GTCCGTGGTTGTGAGTTTTG Ccl9 chemokine (C-C motif) ligand 9 NM_011338 288 2231-2518 TCCTGACACTTGGCTGAAAG CTGTAGCCAACGGAATGCTA Ccl9 chemokine (C-C motif) ligand 9 NM_011338 277 77-353 CCAGGGACTTCCTGATCCTC AGGACAGGCAGCAATCTGAA Ccna1 cyclin A1 NM_007628 186 822-1007 TTCTGAGAGGGAAATTGCAG TTGGAACGGTCAGATCAAAT Ccna1 cyclin A1 NM_007628 178 761-938 CGCACAGAGACCCTGTACTT TGTACGTATCGTCGGTGATG Ccna1 cyclin A1 NM_007628 158 1412-1526 GCTCTGAGGTTTCTGCGAGT TTTCACAGCCAAACAGCAAG Ccna1 cyclin A1 NM_007628 134 52-185 ATCGCCCAGACAGAGAAGAA GCATTTGACAAGCATCAGGA Ccna2 cyclin A2 NM_009828 212 1058-1269 CTTGGCTGCACCAACAGTAA ATGACTCAGGCCAGCTCTGT Ccnb1 cyclin B1 NM_172301 171 1193-1363 AAGACTCCCTGCTTCCTGTT CGGCCTTAGACAAATTCTGA Ccnb1 cyclin B1 NM_172301 232 872-1103 TAGGTGACTTCGCCTTTGTG TGAGAAGGAGCAAAATGCAC Ccnb1 cyclin B1 NM_172301 242 378-619 TGAGCCTGAACCTGAACTTG CCAGTTGTCGGAGATAAGCA Ccnb1 cyclin B1 NM_172301 216 783-998 CAGTTGTGTGCCCAAGAAGA CTACGGAGGAAGTGCAGAGG Ccnb2 cyclin B2 NM_007630 238 977-1214 AGTACCTGATGGAGCTGACG TTGTTCTTGACAGCGATGAA Ccnb2 cyclin B2 NM_007630 181 477-657 TAACGAGGACAGGGAGAACC CCGAAACTTGGAATGGACTT Ccnb2 cyclin B2 NM_007630 162 1128-1289 TGAAGTCCTGGAAGTCATGC GAGGCCAGGTCTTTGATGAT Ccnb2 cyclin B2 NM_007630 195 846-1040 CCAAATCCGAGAAATGGAGA GCCACCTGAGAAGGATGGTA Ccnc cyclin C NM_016746 246 736-981 GACGGATCTCTGTCTGCTGT TCACTGTTTGGAGGTGGTTT Ccnc cyclin C NM_016746 197 3073-3269 GTAGGGTGGCCATCTCTTGT GAAACCCAACATGTTTGCAC Ccnc cyclin C NM_016746 182 2438-2619 TCCACTTGGATGCTTGGTAA TATTTCACGGCTTTGTCTGC Ccnd1 cyclin D1 NM_007631 240 2419-2658 CCATGACCAGTGTGACTCAA TTGGAGTCCCCTAATTTTCC Ccnd1 cyclin D1 NM_007631 217 2313-2529 CAAGGAGATTGGGGACAACT GCCCAATGAAAGACCAATCT Ccnd1 cyclin D1 NM_007631 246 2690-2935 GCCCCCAAGTTAACAACAGT ATAGCAGCGAAAACAACGTG Ccnd1 cyclin D1 NM_007631 153 1970-2122 AAACCCACAGCTTTTGTGTG ATCCCCATCCATTCCATTAG Ccnd1 cyclin D1 NM_007631 233 2024-2256 CCAAAACCATTCCATTTCAA CCTTCAACTTTGCAGGACAG Ccnd1 cyclin D1 NM_007631 232 3264-3495 GGCACCTGGATTGTTCTGTT CAGCTTGCTAGGGAACTTGG Ccnd1 cyclin D1 NM_007631 238 369-606 AGTGCGTGCAGAAGGAGATT CACAACTTCTCGGCAGTCAA Ccnd1 cyclin D1 NM_007631 180 278-457 GCGTACCCTGACACCAATCT CTCTTCGCACTTCTGCTCCT Ccnd1 cyclin D1 NM_007631 163 572-734 AAGGAGACCATTCCCTTGAC TTTTGGAGAGGAAGTGTTCG Ccnd2 cyclin D2 NM_009829 163 4803-4965 GCTGCTTTGGTTTGAACTGT ACCCTGCTAGCAACAAGATG Ccnd3 Cyclin D3 NM_007632 217 1621-1837 TGCCGTGGTCATTTTAATTT CCTAACCCTGCTCTGATGAA Ccnd3 Cyclin D3 NM_007632 198 310-507 GAGCCTCCTACTTCCAGTGC GGCAGACGGTACCTAGAAGC Ccnd3 Cyclin D3 NM_007632 209 1388-1596 GCTCCAACCTTCTCAGTTGC AGCTAAGCAGCAAGCAAAGC Ccne1 cyclin E1 NM_007633 152 1647-1798 ACCACTGAGTGCTCCAGAAG TCACAGCCTATCAACAGCAA Ccne2 cyclin E2 NM_001037134 205 1225-1429 TGTGAGTCCAGTGAAGCTGA TCAGTGTTTTCCTGGTGGTT Ccne2 cyclin E2 NM_001037134 205 222-426 GACGCAGTAGCCGTTTACAA ATAATGCAAGGGCTGATTCC Ccne2 cyclin E2 NM_001037134 156 1054-1209 TCTGTGCATTCTAGCCATCG ACAAAAGGCACCATCCAGTC Ccnf cyclin F NM_007634 227 1340-1566 AAGAGGTCCTGCTGACACTG GACACAGGGTACGAGGTCAC Ccnf cyclin F NM_007634 178 348-525 TTCTCCACAGAACCTGAAGC ATTCAGTCTCTCAGCCATGC Ccnf cyclin F NM_007634 156 1037-1192 TAATCGACTGGTTGGTGGAA GGGTACAGATGACCATGCAG Ccng1 cyclin G1 NM_009831 186 2060-2245 TTCATTCTTCAGGACCCACA GCAAACAACACAGACCCAAC Ccng1 cyclin G1 NM_009831 238 270-507 AAGACGTGGCTGTCAAGATG AGGGAAAATGTCTCCGTGTC Ccng1 cyclin G1 NM_009831 159 474-632 AGTTCTTTGGCTTTGACACG GTGGGACATTCCTTTCCTCT Ccng2 cyclin G2 NM_007635 186 336-521 GCTGATCTTGATGGAGGCTA GACAGGTGTTTCGGTTTCAC Ccnh cyclin H NM_023243 179 873-1051 GTCCTGAAACAGAAGCTGGA GCTGCGGTCATTTATTATGG Ccnt1 cyclin T1 NM_009833 233 20-252 ACAACAACAAGCGGTGGTAT AGCCATGGAATATCGATGAA Ccnt1 cyclin T1 NM_009833 154 1315-1468 CCCATTGAGAGCTCAGAAAA CCCCTGCAGAGTGAACTTTA Ccnt1 cyclin T1 NM_009833 169 1835-2003 CTGGGCATAGCTCAGACACA GCACTAAGCAGGGAGTGGAG Ccnt1 cyclin T1 NM_009833 233 20-252 ACAACAACAAGCGGTGGTAT AGCCATGGAATATCGATGAA Ccnt1 cyclin T1 NM_009833 225 1005-1229 GTCTTCCCAACCTCCGTTTA ATGTTCTCCAGCTGCCTCTT Ccnt1 cyclin T1 NM_009833 233 1518-1750 GGAGAAGCAGAGGACTCACC ATACTGCTGCCCCAGTCTCT Ccr1 Chemokine (C-C motif) receptor 1 NM_009912 163 614-776 TGGGCAATGTCCTAGTGATT GCATCACCAAAAATCCAGTC Ccr2 Chemokine (C-C motif) receptor 2 NM_009915 208 2309-2516 GGAGAAAAGCCAACTCCTTC AGGCAGTTGCAAAGGTACTG Ccr3 Chemokine (C-C motif) receptor 3 NM_009914 173 2334-2506 GAGGTGCTCTCTGGATTGAA TTGAGTCTCTGAACGCATCA Ccr3 Chemokine (C-C motif) receptor 3 NM_009914 Ccr3 Chemokine (C-C motif) receptor 3 NM_009914 Ccr4 Chemokine (C-C motif) receptor 4 NM_009916 232 47-278 GGCAGCTCAACTGTTCTCAT ATTTCCAAACAGACCCAACA Ccr5 Chemokine (C-C motif) receptor 5 NM_009917 193 950-1142 GGCAACAGAGACTCTTGGAA TCCTGTGGATCGGGTATAGA Ccr6 Chemokine (C-C motif) receptor 6 NM_009835 221 61-281 AGGGAACAGTGACCATTTGA CACAGTACCCCAGAAAATGC Ccr6 Chemokine (C-C motif) receptor 6 NM_009835 Ccr6 Chemokine (C-C motif) receptor 6 NM_009835 Ccr7 Chemokine (C-C motif) receptor 7 NM_007719 212 1452-1663 ACGACAGCCAAAAGTGAAAG GCTCTGTGGGAGCATTTAGA Ccr8 Chemokine (C-C motif) receptor 8 NM_007720 211 438-648 CCCTAATGAGTGTGGACAGG TTCCACCTCAAAGACTGCTC Ccr8 Chemokine (C-C motif) receptor 8 NM_007720 Ccr8 Chemokine (C-C motif) receptor 8 NM_007720 Ccr9 Chemokine (C-C motif) receptor 9 NM_009913 183 2236-2418 CTAGCCTTTGGGACTTCCTC CACTACCATGCCCAACCTAC Ccr9 Chemokine (C-C motif) receptor 9 NM_009913 Ccr9 Chemokine (C-C motif) receptor 9 NM_009913 CD19 CD19 antigen NM_009844 216 175-390 TGAGAAGCTGGCTTGGTATC CCACTATCCTCCACGTTCAC CD19 CD19 antigen NM_009844 163 1701-1863 TTCGTTAGGTCCCAAGAACC TTATTTGGGGAAAGCAAAGG CD19 CD19 antigen NM_009844 223 201-423 ACCAGTCAACACCCTTCCTG CTGACGTCTGAAGCATTCCA CD22 CD22 antigen NM_001043317 226 610-835 GCCACAAAGACTGAGAAGGA GCATCTGGATGTAAGGTTGG CD22 CD22 antigen NM_001043317 224 2689-2912 GCAATGGATGACACCGTTAG CCAAACTGAACCAGCTCTGA CD22 CD22 antigen NM_001043317 154 1014-1167 GAGCAAGCTCACCTTCCAAC CACCTCTGTGGGATTGACCT Cd28 CD28 antigen NM_007642 252 3401-3652 AGCTGTGGTTGGTTTGCTAC GCTGGGATGAGAGATCAGAC Cd28 CD28 antigen NM_007642 168 956-1123 GATCATTCATTCAGCCTTGG CACCCCAAACACCAACTTAG Cd3e apolipoprotein A-IV NM_007468 293 479-771 CAGCTCAGTACCCTCTTCCA TTCATTTCCTGGGTCTGTGT Cd3e apolipoprotein A-IV NM_007468 258 224-481 GCACAGGGACACAGGTACAC CTGCTGAGTGACATCCGTCT Cd3e apolipoprotein A-IV NM_007468 172 462-633 AGACGGATGTCACTCAGCAG TCCTCCAGCTCCTTCTTGAT Cd4 CD4 antigen NM_013488 289 508-796 GCTGGAGAACAGGAAAGAGG CTGAAAACCCAGCACTGAGA Cd4 CD4 antigen NM_013488 296 779-1074 TCAGTGCTGGGTTTTCAGAG GTCAGAGTCAGGTTGCCAGA Cd4 CD4 antigen NM_013488 107 1098-1204 AGGAAGTGAACCTGGTGGTG CTCCTGCTTCAGGGTCAGTC Cd4 CD4 antigen NM_013488 238 1105-1342 GAACCTGGTGGTGATGAAAG CACCCCTCTGGATAAAACCT Cd4 CD4 antigen NM_013488 153 399-551 CTTCGCAGTTTGATCGTTTT CTTTGAACACCCACAACTCC Cd4 CD4 antigen NM_013488 152 2728-2879 AGAGTGAGGCTGGGAGAGAT CTCAGGGAGAGCCCTTAGAC Cd40 CD40 antigen NM_011611 153 1390-1542 AGGCAGGTAAGATGGCTTTT CGGGGTACATTACCACAGAG Cd47 CD47 antigen NM_010581 184 1498-1681 TGGTATCCAGCAAGCCTTAG AAGACACCAGTGCCATCAAT Cd47 CD47 antigen NM_010581 241 995-1235 CCCCTTTTGATTTCAGGTTT CATGTTTTCCTGGATGGAAG Cd47 CD47 antigen NM_010581 151 1170-1320 AGGTCTTCACGACTCACAGC CCAATTGGTTACACAGCACA Cd55 CD55 antigen NM_010016 156 703-858 TTGATTGGGACGATGAGTTT CATTTCCAACCAGGATGAAG Cd55 CD55 antigen NM_010016 233 1646-1878 TAAACCAAAGTCCCCAAACA ACTGTGTGCTGAGGAAGGAG Cd55 CD55 antigen NM_010016 247 246-492 AGCAAAGTGGCATACTCGTG CTGGGAGTGGAGGTTGTTTT Cd84 CD84 antigen NM_013489 211 596-806 AATGTCCTTCAAATCGTCCA GGAACAGAAATGCCAACATC Cd84 CD84 antigen NM_013489 172 1557-1728 ATGTCCGAATTTAGGGGAAG AAGCGCATTTGTTTCAGTTC Cd84 CD84 antigen NM_013489 215 223-437 AATTGACAACATTGCCTGGA TCTTGGTGATGGTTTCCTCA Cd84 CD84 antigen NM_013489 210 600-809 TCCTTCAAATCGTCCACTCC AACGGAACAGAAATGCCAAC Cd8a CD8 antigen, alpha chain, isoform 1 NM_001081110 215 555-769 GCCAGTCCTTCAGAAAGTGA TGATGATCAAGGACAGCAGA Cd8a CD8 antigen, alpha chain, isoform 1 NM_001081110 285 317-601 CTTGGCTCTTCCAGAACTCC GCAGCACTGGCTTGGTAGTA Cd8a CD8 antigen, alpha chain, isoform 1 NM_001081110 167 542-708 TCAGTTCTGTCGTGCCAGTC ATCACAGGCGAAGTCCAATC Cdc16 CDC16 cell division cycle 16 homolog NM_027276 202 1417-1618 GCAATTGGAAATGAGGTCAC AGTCCACAGCGTTTTCAAAG Cdc16 CDC16 cell division cycle 16 homolog NM_027276 239 715-953 TTGCTGCGATTTGTATTTGA TTCAGCTCCACAAGAGTTCC Cdc16 CDC16 cell division cycle 16 homolog NM_027276 181 1622-1802 TCCACACAGCTCTTGGTCTC GGAGGCGAAATGATGTTTTT Cdc20 cell division cycle 20 homolog NM_023223 180 402-581 TGGCAAATCTAGTTCCAAGG AGGTTGAGAGACCAGGCTTT Cdc20 cell division cycle 20 homolog NM_023223 159 854-1012 CTGGTTCTGGTGACATCCTG TGTTTCGAAGTCGTTTCTGC Cdc20 cell division cycle 20 homolog NM_023223 152 466-617 CAACGCAGTGCTTCTCAAAT CTGAGGATCTTGGCTTCCTC Cdc20 cell division cycle 20 homolog NM_023223 221 886-1106 atggagcagcctggagacta acatcatggtggtggatgtg Cdc20 cell division cycle 20 homolog NM_023223 150 423-572 tcagaccacccctagcaaac gaccaggctttctgatgctc Cdc25a cell division cycle 25 homolog A NM_007658 167 1726-1892 GATAGGCTCGGCAATGAGTA TTGGTGCGGAACTTCTTTAG Cdc25a cell division cycle 25 homolog A NM_007658 230 2065-2294 CTTCCATTCCTTGGACCTGT GGCTTTTCTCTCCTCGTGAC Cdc25a cell division cycle 25 homolog A NM_007658 175 1584-1758 TCTGCACATGGAAGAAGAGG GTGGAGCTTGGGGTACTCAT Cdc25c cell division cycle 25 homolog C NM_009860 165 904-1068 AGCTGGAAATGAAGCATCTG CACAGAGTGGGACCATCTTC Cdc25c cell division cycle 25 homolog C NM_009860 156 1027-1182 ACGCCAAGGGCTTAAGTCTA ACTTCAGATCCGGGTGTTTC Cdc25c cell division cycle 25 homolog C NM_009860 221 476-696 CCGTTCAGATTTCCCTGAAT GGTGAAAATCCTTGCCAGTT Cdc2a cell division cycle 2 homolog A NM_007659 224 440-663 CTCCAGGGAATTGTGTTTTG ATGTCAACCGGAGTGGAGTA Cdc34 cell division cycle 34 homolog NM_177613 188 495-682 GTGCATCTCCATTCTCCATC TGCTCTCCTTCCATTTTCTG Cdc34 cell division cycle 34 homolog NM_177613 157 1079-1235 TTTGGAGAAGAGCTGTGGTG CACACCAAAAGCAGAGAGGA Cdc34 cell division cycle 34 homolog NM_177613 167 463-629 TGGCACCCAAACATCTATGA AAGGTGTTGGGCTCATTCAG Cdh1 cadherin 1 NM_009864 238 3509-3746 TCTTGGCGTTTCTTTCAAAC CAAAGATTCCAGCCAGAAAA Cdh1 cadherin 1 NM_009864 157 667-823 CAAATCCAACAGGGACAAAG GAGGATGTACTTGGCAATGG Cdh1 cadherin 1 NM_009864 188 3293-3480 TTTCGTGGTATTCCCTCTCC GCAGGTTCTGATCAAAGCAA Cdh11 cadherin 11 NM_009866 217 323-539 TGGGTGAAGAAGAAGCTGAC CAGGGCAGCTTGTAAACAGT Cdh11 cadherin 11 NM_009866 180 1707-1886 GTGGTTGGGAGAGTACATGC TGCGAAGACAGAGATGTTGA Cdh11 cadherin 11 NM_009866 230 2108-2337 AATCATGCACAACCCAAACT GGATGTAGGCTTCAGCGTTA Cdh13 cadherin 13 NM_019707 186 240-425 CCAGCCTGTCCTAAACTTGA AGTTCTGCCATGTCTTCAGC Cdh13 cadherin 13 NM_019707 178 783-960 AGTGCCTCTGGAAGTCATTG ACGGATGTTGTACCTCAGGA Cdh13 cadherin 13 NM_019707 187 1261-1447 AAAGACGACCCTACCACAGG GTGGGTCCTCATTCTCCACT Cdh13 cadherin 13 NM_019707 156 405-560 TGCTGAAGACATGGCAGAAC GGCTGTCTCTGGTTCTCTGG Cdh13 cadherin 13 NM_019707 227 84-310 CTTCTAGTCGGGCAAGATGC GGCTTGAGACCTCGTAGTGC Cdh13 cadherin 13 NM_019707 194 1416-1609 CCTGCTGATCAAAGTGGAGA GGTCTGTGGCATTCACTGTC Cdh22 cadherin 22 NM_174988 246 3336-3581 CCCAGAGAAGTGGATGTGAC ACAAAGGCGAGCATTTATTG Cdh22 cadherin 22 NM_174988 186 805-990 GACCATCTTCCTGATTGACG AGAAAGCGTGGTTCACTGTC Cdh22 cadherin 22 NM_174988 166 1060-1225 CTCTGATGCAGACGACCCTA GGCTTGAATAACCACCTCGT Cdh22 cadherin 22 NM_174988 170 1995-2164 AGGCAGCTGTGTGTGAAGAC CACCGCAGCTGTGTTATCTT Cdh22 cadherin 22 NM_174988 161 547-707 GCTGCTGTTTCTGCTACTGC ACTCCTCCACCACGAAGAAC Cdh22 cadherin 22 NM_174988 237 2302-2538 TACCATCCAGTCCTGCAACA ATGTCATAGGCCTCGGTGTC Cdh22 cadherin 22 NM_174988 217 934-1150 CGAGTCGGAGTTCATCATCA CTTGGGGTCCACTGTGAAGT Cdh22 cadherin 22 NM_174988 174 1273-1446 CACCATCGTGGTTACTGACG CCGCTCTCTTCTCTCAGGTG Cdh22 cadherin 22 NM_174988 239 3212-3450 AAGATGAAGGAAGGGCTGGT ACTGAGGCCCAGAGAAATGA Cdh22 cadherin 22 NM_174988 Cdh22 cadherin 22 NM_174988 Cdh22 cadherin 22 NM_174988 Cdk2 cyclin-dependent kinase 2 NM_183417 173 748-920 TGGGCTGCAAGTACTACTCC TTGTGATGCAGCCACTTCTA Cdk2 cyclin-dependent kinase 2 NM_183417 179 1962-2140 CAGGACTTTGCCCTCACTAA CCAGGTCAAAGCCTTACAAA Cdk2 cyclin-dependent kinase 2 NM_183417 238 518-755 CATTCCTCTTCCCCTCATCA GCAGCCCAGAAGAATTTCAG Cdk4 cyclin-dependent kinase 4 NM_009870 215 619-833 CAAGTAATGGGACCGTCAAG GGCTTCAGAGTTTCCACAGA Cdk5 cyclin-dependent kinase 5 NM_007668 195 1499-1693 CAGAGCTGTGTGGGTCTCTT CCTCTCCATAGGAGCTGACA Cdk5r1 cyclin-dependent kinase 5, regulatory subunit (p35) NM_009871 201 3207-3407 TAACAGGATTCCAGCTTTGC CTAGCGGTCGTTCCTTTACA Cdk5r1 cyclin-dependent kinase 5, regulatory subunit (p35) NM_009871 194 1472-1665 GTGTCTAGCAGAGCCACCAA GTACAGGTGACATGGGCAAG Cdk5r1 cyclin-dependent kinase 5, regulatory subunit (p35) NM_009871 193 1807-1999 GGATCCAGGAGGTTGTGAGT CTAACGTGGGAGCAGAGACA Cdk5rap1 CDK5 regulatory subunit associated protein 1 NM_025876 247 577-823 ACCTCTGAGGATTGGGATTC CCGCATAATGGATACAAAGG Cdk5rap1 CDK5 regulatory subunit associated protein 1 NM_025876 181 743-923 TCTCTGGATGAGACCTACGC ACAGCTTCCTCACTTCATCG Cdk5rap1 CDK5 regulatory subunit associated protein 1 NM_025876 178 365-542 CTCGAGACCTATGGCTGTCA TGAGCTGATGTAAGCGGTTC Cdk6 cyclin-dependent kinase 6 NM_009873 219 862-1080 TGACGAACTAGGCAAAGACC CCAATGTGTTCAGATGACGA Cdk6 cyclin-dependent kinase 6 NM_009873 250 58-307 GGAGAAGGACAGCCTGAGTC TGTGCACACATCAAACAACC Cdk6 cyclin-dependent kinase 6 NM_009873 177 993-1115 TGAATCACCCGTACTTCCAA TGCTCTGAGAGGCTTGCTTA Cdk7 cyclin-dependent kinase 7 NM_009874 239 1548-1786 CCCTGATGTCCTGTCATCTC CCAGGCTGTCCTCAAACTTA Cdk7 cyclin-dependent kinase 7 NM_009874 169 2918-3086 TACCATAAAACCCCGTCTCA TGCTGAAGTCTGCATAACCA Cdk7 cyclin-dependent kinase 7 NM_009874 172 6325-6496 AGTGACCCACTGTTCCCTTC CAAGGATAGGGTCCACGAGT Cdk7 cyclin-dependent kinase 7 NM_009874 161 5816-5976 tgagggtcagaggacagctt agaccctgtttccacaccag Cdk7 cyclin-dependent kinase 7 NM_009874 164 6882-7045 accatgccagcagctctagt gggtgtacacgcacacaaac Cdk8 cyclin-dependent kinase 8 NM_153599 195 204-398 GGCATGCAGAGAGATAGCAT ATTCCCCGAGGTAACTGAAC Cdk8 cyclin-dependent kinase 8 NM_153599 190 2121-2310 TAGAAGCCTGTTGGTTCAGC ACAGAAGAGTGCGGACTGAC Cdk8 cyclin-dependent kinase 8 NM_153599 193 1107-1299 GCCTGATGAGAAAGGAGACA TGGATTGGAACGCTGATAGT Cdk8 cyclin-dependent kinase 8 NM_153599 171 1006-1176 atgcaggacccctacttcct gccagttccgttagtgtggt Cdk8 cyclin-dependent kinase 8 NM_153599 173 832-1004 aagatgcccgaacattcaac gcctgctctgaggtaattcg Cdk9 cyclin-dependent kinase 9 NM_130860 289 AACCAGACGGAATTTGAACG CCTCCCACCATGCAAGTAGT Cdk9 cyclin-dependent kinase 9 NM_130860 244 TGGACCTCATTGACAAGCTG CGTTCAAATTCCGTCTGGTT Cdk9 cyclin-dependent kinase 9 NM_130860 174 GAATGAGAAGGAGGGGTTCC GCAAGGTCATGCTCACAGAA Cdk9 cyclin-dependent kinase 9 NM_130860 232 786-1017 GGCAGAGATGTGGACTCGTA CAGCAGCTTGTCAATGAGGT Cdk9 cyclin-dependent kinase 9 NM_130860 243 CGATGAGGTCACCAAGTACG CGGTTATACGGTGAGGCTTT Cdk9 cyclin-dependent kinase 9 NM_130860 296 415-710 AAGGGCAGCATCTATCTGGT TACCACAATGTCACCACACG Cdkn1a cyclin-dependent kinase inhibitor 1A NM_007669 217 1152-1368 TGCTCAGACCTGTGAAGACA CTTCCAGTCCACTGAGCTGT Cdkn1a cyclin-dependent kinase inhibitor 1A NM_007669 179 643-821 GCCTTAGCCCTCACTCTGTG AGGGCCCTACCGTCCTACTA Cdkn1a cyclin-dependent kinase inhibitor 1A NM_007669 218 856-1073 TATTTAAGCCCCTCCCAACC AGCTGGCCTTAGAGGTGACA Cdkn1b cyclin-dependent kinase inhibitor 1B NM_009875 190 360-549 GCTCTGCTCCATTTGACTGT GCTCCCGTTAGACACTCTCA Cdkn1b cyclin-dependent kinase inhibitor 1B NM_009875 224 712-935 CAGAATCATAAGCCCCTGGA TCTGACGAGTCAGGCATTTG Cdkn1b cyclin-dependent kinase inhibitor 1B NM_009875 155 2069-2223 AGCGTTTCTTCATTGCCTGT CACAAAACATGCCACTTTGG Cdkn1c cyclin-dependent kinase inhibitor 1C NM_009876 189 1661-1849 TCTAGGGGAATGGTTGTTGA GATTTTTGTTGGGCCTCTTT Cdkn2a cyclin-dependent kinase inhibitor 2A NM_009877 244 107-350 GGTTCTTGGTCACTGTGAGG AGTTCGAATCTGCACCGTAG Cdkn2a cyclin-dependent kinase inhibitor 2A NM_009877 172 680-851 CCCGCCTTTTTCTTCTTAGC TTCTCATGCCATTCCTTTCC Cdkn2a cyclin-dependent kinase inhibitor 2A NM_009877 139 43-181 CTCACCTCGCTTGTCACAGT GCACGAACTTCACCAAGAAA Cdkn2b cyclin-dependent kinase inhibitor 2B NM_007670 228 709-936 CATTTTCTGCAGCTGGATCT TTCACAGGGGAAGGTACTGA Cdkn2c cyclin-dependent kinase inhibitor 2C NM_007671 155 348-502 CGCTGCAGGTTATGAAACTT GAACTCCAGCAAAGCCTGTA Cdkn2c cyclin-dependent kinase inhibitor 2C NM_007671 217 163-379 GCAAAGGAAAGGGGAAAAAG CTCCGGATTTCCAAGTTTCA Cdkn2c cyclin-dependent kinase inhibitor 2C NM_007671 164 574-737 CCCTGTGGTGGAGTTCCTTA ACATTCACTGCAGGCTTGTG Cdkn2d cyclin-dependent kinase inhibitor 2D NM_009878 248 716-963 GAACCTCATGGACATTCTGC CCTTCTTTGTCCAACACACC Cdkn2d cyclin-dependent kinase inhibitor 2D NM_009878 110 838-947 TCCATTGAAGAAGGGAGTGG CACCAAAAGGGGTGAGAAAA Cdkn2d cyclin-dependent kinase inhibitor 2D NM_009878 203 928-1130 TTTTCTCACCCCTTTTGGTG GCTCACACTTCAGGGCTCTC Cdkn3 cyclin-dependent kinase inhibitor 3 BC049694 179 483-661 CGGAAAACCCTGATACATTG TCCCGGAATTCATGAAGATA Cdkn3 cyclin-dependent kinase inhibitor 3 BC049694 111 470-580 CCTCAAAAACAACCGGAAAA GCTTGCTGTGGTGAGATTGA Cdkn3 cyclin-dependent kinase inhibitor 3 BC049694 122 188-309 GCGAGTGAATTGTTCCCAGT ACACGTCTTGGATCCCGTAG Cebpb CCAAT/enhancer binding protein (C/EBP), beta NM_009883 195 TTCTACTACGAGCCCGACTG GAAGAGGTCGGAGAGGAAGT Cebpb CCAAT/enhancer binding protein (C/EBP), beta NM_009883 150 1304-1453 GGGTTGTTGATGTTTTTGGT CTCGAAACGGAAAAGGTTCT Cebpb CCAAT/enhancer binding protein (C/EBP), beta NM_009883 155 AAGCTGAGCGACGAGTACAA AGCTGCTCCACCTTCTTCTG Centg2 centaurin, gamma 2 NM_178119 213 7184-7396 CTCAGTGTGCCACCTTCTCT GGCTAAAACCCCATTCATCT Centg2 centaurin, gamma 2 NM_178119 244 9097-9340 TCCACCTTGAGTCTTCTTGC ATCAGTCATCGGGAAACGTA Centg2 centaurin, gamma 2 NM_178119 193 7514-7706 CAAGAAGCAGGGACAGTTGA CAAAGAACAGCAGGTCCAGA Centg2 centaurin, gamma 2 NM_178119 165 4608-4772 TCAAAACACCAGACCCACAA GTGCTGAAGGTGTCCGGTAT Cflar CASP8 and FADD-like apoptosis regulator NM_207653 185 5063-5247 CAGATGTGCACAGTGATGGT GGGATTTGAACTCTGGACCT Chek1 checkpoint kinase 1 homolog NM_007691 167 1081-1247 GAACGTGGACAAACTGGTTC ATTTGTCCGCATCCAATTTA Chek2 CHK2 checkpoint homolog NM_016681 227 79-305 AAGGCTCATGACAGTGCTTC GGTTCTTGGTCCTCAGGAAT Chuk conserved helix-loop-helix ubiquitous kinase NM_007700 170 509-678 TCAAGATGTTGGTGGGAAGA TCCCAAAGCTCCAATAATCC Cidea cell death-inducing DNA fragmentation factor, alpha subunit-like effector A NM_007702 243 616-858 TAGCCAGAGTCACCTTCGAC ATGGCTGCTCTTCTGTATCG Cideb cell death-inducing DNA fragmentation factor, alpha subunit-like effector B NM_009894 188 9-196 ACGCTTGACTCACCTCTCAC CCGAGCTCACAGTGGATACT Cirbp cold inducible RNA binding protein NM_007705 160 281-440 ATGAATGGGAAGTCTGTGGA CTCCTCCTCCTCTGGAGAAC Cirbp cold inducible RNA binding protein NM_007705 171 502-672 CTACTATGCCAGCCGGAGTC TACACAACGATCAGCGAAGC Cirbp cold inducible RNA binding protein NM_007705 160 281-440 ATGAATGGGAAGTCTGTGGA CTCCTCCTCCTCTGGAGAAC Cirbp cold inducible RNA binding protein NM_007705 238 771-1008 GGAAGCGCTGTCTGTTTTTA ATCGAGTCCATTCCATCTCA Cirbp cold inducible RNA binding protein NM_007705 171 502-672 CTACTATGCCAGCCGGAGTC TACACAACGATCAGCGAAGC Cks1b CDC28 protein kinase 1b NM_016904 204 115-318 GACGACGAGGAGTTCGAATA TCATTTCTTTGGCTTCTTGG Cks1b CDC28 protein kinase 1b NM_016904 175 449-623 GCTGGTACCTGCTTTGCTTC CACGTCAGCAAATTCACACC Cks1b CDC28 protein kinase 1b NM_016904 237 145-381 ATGTTGCCCAAGGACATAGC GAAAGATGGCAGGGAGTGAG Cks1b CDC28 protein kinase 1b NM_016904 181 299-479 ccaagaagccaaagaaatga gctcaactccagaagcaaag Cks1b CDC28 protein kinase 1b NM_016904 155 63-217 ctcggacagagcaatcatgt cgaggttcctccattcagat Cks2 CDC28 protein kinase regulatory subunit 2 NM_025415 219 312-530 GGAGACTTGGTGTCCAACAG GCACAGGTATGGATGAAAGG Cks2 CDC28 protein kinase regulatory subunit 2 NM_025415 145 292-436 GATGTCCGAAGAGGAGTGGA GATCCCAGCTGCACTTCATT CKS2 CDC28 protein kinase regulatory subunit 2 NM_025415 120 421-540 AAGTGCAGCTGGGATCATCT TACAGCGCATGCACAGGTAT Cldn1 claudin 1 NM_016674 245 621-865 CACAGCATGGTATGGAAACA TCTTCCTTTGCCTCTGTCAC Cldn1 claudin 1 NM_016674 188 846-1033 GTGACAGAGGCAAAGGAAGA TGCTCAGGGAAGATGGTAAG Cldn1 claudin 1 NM_016674 187 2173-2359 GGTGCTGTTTTGTTTTGACC GCAATACATGTAGGGCAACC Cldn2 claudin 2 NM_016675 217 1178-1394 GTAAGGTGCTGCTGAGGGTA TCTGGGCATAGCCTAAAGTG Cldn2 claudin 2 NM_016675 227 2361-2587 CCAGTGTGGAACATCTGTGA GGATCTTCTGAAGCTGGTGA Cldn2 claudin 2 NM_016675 160 635-794 GTCCTCGCTGGCTTGTATTA GATGCCATGAAGATTCCAAG Clu clusterin NM_013492 190 962-1151 CCAGCCTTTCTTTGAGATGA CTCCTGGCACTTTTCACACT Clu clusterin NM_013492 162 520-681 CATTCCCGGAAGTGTGTAAC AGAAGGGTGAGCTCTGGTTT Clu clusterin NM_013492 187 130-316 GCTATAAATAGGGCGCTTCC TTGTCAGAGACCTCCTGCTC Cnn1 calponin 1 NM_009922 158 405-562 CCTGTTTGAAAACACCAACC TGTTCCTGCCTTCTCTCAAC Cnn1 calponin 1 NM_009922 150 36-185 GTCATCTGCACCTCTGCTTT CACTCTCTCAGCTCCTGCTC Cnn1 calponin 1 NM_009922 160 2079-2238 AAGTTGTTTGCTGCCAAGTC ATCACAAATCCTGCCTCAAA Cntnap2 contactin associated protein-like 2 NM_001004357 161 5917-6077 ACCTTATCCCAAGCTGCTCT TTCATGGGACTGTTTGAGGT Cog8 component of oligomeric golgi complex 8 NM_139229 236 2762-2997 GAGCCAACTGAACTCCTGAA TGAATGTGAAGCATGGAATG Cog8 component of oligomeric golgi complex 8 NM_139229 243 1426-1668 ACCTTGGAAAATGCCCTTAC GTTCACGTGTCCAAGGTTTC Cog8 component of oligomeric golgi complex 8 NM_139229 184 1401-1584 GGCTCTAGCACAGGATGTGA GACTTGAAGACAGCGGTTCA Col18a1 collagen, type XVIII, alpha 1 NM_001109991 154 4953-5106 TAGCCTGGGATCTTTCTGTG CCAGTTACCACCTGGATGAG Col18a1 collagen, type XVIII, alpha 1 NM_001109991 Col18a1 collagen, type XVIII, alpha 1 NM_001109991 Col4a1 collagen, type IV, alpha 1 NM_009931 133 1738-1870 GCAGAGATGGTCTTGAAGGA AAACCTGGGTCTCCTTTGTC Col4a1 collagen, type IV, alpha 1 NM_009931 148 3257-3404 AGGATCAGTTGGAGGAATGG AATCCCAATGCCAGGTAGAC Col4a1 collagen, type IV, alpha 1 NM_009931 132 5654-5785 CCACTGTCCAGTGTTTCCAC CCACACAGGGCATAAGTTTG Cpa2 carboxypeptidase A2 NM_001024698 185 164-348 CCTTGAGCTTGATTTTTGGA GCTGGTTGAACAGCATCTCT Cpa2 carboxypeptidase A2 NM_001024698 166 626-791 TCCAGCCATCACTTCTCTTC GTCCCAGTTCCGATTAGGAT Cpa2 carboxypeptidase A2 NM_001024698 191 210-400 GTCCATGTCCGAGTTCCTTT TCTTCCAGGGTATGGTAGGC Crabp1 cellular retinoic acid binding protein I NM_013496 161 275-435 ACCACGGAGATCAACTTCAA AGCTCTCGGGTCCAGTAAGT Crabp1 cellular retinoic acid binding protein I NM_013496 158 544-701 CGAGTTCCCCTGAGGAGTAT CCAAACCAAGGGTACACAAG Crabp1 cellular retinoic acid binding protein I NM_013496 160 330-489 GACGCAAATGCAGGAGTTTA CTTGTGCACACCACATCATC Crabp1 cellular retinoic acid binding protein I NM_013496 170 235-404 CGGGGATCAGTTCTACATCA CCCCCTCAAGAAGTGTCTGT Crabp1 cellular retinoic acid binding protein I NM_013496 233 388-620 GACACTTCTTGAGGGGGATG TATTCATGGGGGAGAGGTGT Cradd CASP2 and RIPK1 domain containing adaptor with death domain NM_009950 189 1267-1455 AGTCATGTGACGACGGAGAT GGCCTCAAGAGAAACACTGA Crp C-reactive protein, pentraxin-related NM_007768 183 715-897 AAAGCACAGGGTGATGTGTT GAGGACCACAAAGCAGAGAA Csn3 casein kappa NM_007786 172 330-501 AATCTCCAAATGGCAATCAA CTCCATGGTAGGAACTGGTG Csn3 casein kappa NM_007786 244 18-261 TGCCAAGCAAGAATTGACTC AGGCAAAGATGGCCTGTAGT Ctgf connective tissue growth factor NM_010217 198 1619-1816 gtaaccggggagggaaatta tacttgccacaagctgtcca Ctnnb1 catenin (cadherin associated protein), beta 1 NM_007614 233 2851-3083 ATTGGCCTGTAGAGTTGCTG AACAAGCAAGGCTAGGGTTT Ctnnd2 catenin (cadherin associated protein), delta 2 NM_008729 201 4848-5048 ATGCCACTGTGTTTCCTCAT GTTGCCACAAACAAATCACA Ctnnd2 catenin (cadherin associated protein), delta 2 NM_008729 188 3836-4023 TGATCAGCCTCAAAGAAAGG TGTGGAAACCTGGTTCTGTT Ctnnd2 catenin (cadherin associated protein), delta 2 NM_008729 198 2790-2987 CGATAGCAAGACCGTTGAAA CACTGGTCCTGGGATTTCTT Ctnnd2 catenin (cadherin associated protein), delta 2 NM_008729 184 5324-5507 GTGTGTCGGTGTATGTGCAA GCTGGCCTAATATCCTGAGC Cul1 cullin 1 NM_012042 226 1627-1852 AACCCAGAAGAGGCAGAACT TGTCTTGAAACATTCGCTGA Cul2 cullin 2 NM_029402 171 3231-3401 ACATAATGGCTGTGGCTCAT ATACAAGATGCCTGGTGGAA Cul3 cullin 3 NM_016716 183 1895-2077 GCAAGTCTCCACTTTCCAGA ATCTCCTTGGACTTGGGTTC Cul3 cullin 3 NM_016716 151 903-1053 AAGGTGGTGGAGAGGGAACT TCTTCAAACCATTTGGCACA Cul3 cullin 3 NM_016716 240 2376-2615 TATTTGGCACGAACACCTGA TGGAAAGCCTGAAGCTCAAT Cul3 cullin 3 NM_016716 154 1759-1912 agctcacactccagcatcac tggaaagtggagacttgcag Cul3 cullin 3 NM_016716 208 1569-1776 atggatgagttcaggcaaca gatgctggagtgtgagctgt Cx3cr1 Chemokine (C-X3-C motif) receptor 1 NM_009987 211 224-434 GTCTGGTGGGAAATCTGTTG CCAAAGAAGCCAATGAAGAA Cx3cr1 Chemokine (C-X3-C motif) receptor 1 NM_009987 Cx3cr1 Chemokine (C-X3-C motif) receptor 1 NM_009987 Cxcl1-2 chemokine (C-X-C motif) ligand 1 NM_008176 204 121-324 TGGGATTCACCTCAAGAACA GTGCCATCAGAGCAGTCTGT Cxcl1-3 chemokine (C-X-C motif) ligand 1 NM_008176 172 649-820 GGGAGGCTGTGTTTGTATGT GACGAGACCAGGAGAAACAG Cxcl1-4 chemokine (C-X-C motif) ligand 1 NM_008176 170 121-290 TGGGATTCACCTCAAGAACA ACTTGGGGACACCTTTTAGC Cxcl1-5 chemokine (C-X-C motif) ligand 1 NM_008176 186 111-296 AGACCATGGCTGGGATTCAC TCCGTTACTTGGGGACACCT Cxcl1-6 chemokine (C-X-C motif) ligand 1 NM_008176 113 142-254 CCAGAGCTTGAAGGTGTTGC TCTGAACCAAGGGAGCTTCA Cxcl1-7 chemokine (C-X-C motif) ligand 1 NM_008176 265 333-597 GAACGCTGGCTTCTGACAAC TCTGCACTTCTTTTCGCACA CXCL2-2 chemokine (C-X-C motif) ligand 2 NM_009140 196 327-522 TGAACAAAGGCAAGGCTAAC ACATCTGGGCAATGGAATTA Cxcl2-2 chemokine (C-X-C motif) ligand 2 NM_009140 196 327-522 TGAACAAAGGCAAGGCTAAC ACATCTGGGCAATGGAATTA CXCL2-3 chemokine (C-X-C motif) ligand 2 NM_009140 258 195-452 TCCAGAGCTTGAGTGTGACG AGGCACATCAGGTACGATCC Cxcl2-3 chemokine (C-X-C motif) ligand 2 NM_009140 209 504-712 AATTCCATTGCCCAGATGTT CACCCTCTCCCCAGAAACTA CXCL2-4 chemokine (C-X-C motif) ligand 2 NM_009140 276 17-292 CAGACTCCAGCCACACTTCA TTCAGGGTCAAGGCAAACTT Cxcl2-4 chemokine (C-X-C motif) ligand 2 NM_009140 180 273-452 AAGTTTGCCTTGACCCTGAA AGGCACATCAGGTACGATCC Cxcl2-5 chemokine (C-X-C motif) ligand 2 NM_009140 151 19-169 GACTCCAGCCACACTTCAGC GGTCTTCAGGCATTGACAGC Cxcl2-6 chemokine (C-X-C motif) ligand 2 NM_009140 268 447-714 GTGCCTCGCTGTCTGAGAGT CTCACCCTCTCCCCAGAAAC Cxcl2-7 chemokine (C-X-C motif) ligand 2 NM_009140 219 149-367 CGCTGTCAATGCCTGAAGAC AGGCTCCTCCTTTCCAGGTC Cxcr3 chemokine (C-X-C motif) receptor 3 NM_009910 156 1346-1501 TCTCAGCAACAAGGACAACA TCTGTGCTATTTGCCTCTCC Cxcr3 chemokine (C-X-C motif) receptor 3 NM_009910 185 146-330 TCTGGAAAACAGCACCTCTC GCTGACTCAGTAGCACAGCA Cxcr3 chemokine (C-X-C motif) receptor 3 NM_009910 174 975-1148 GATGTGGCCAAGTCAGTCAC TTCTCTCCGTGAAGATGACG Cxcr4 chemokine (C-X-C motif) receptor 4 NM_009911 188 358-545 GTCATCACACTCCCCTTCTG AGTTTCCTTGGCCTCTGACT Cxcr4 chemokine (C-X-C motif) receptor 4 NM_009911 249 701-949 tggtgtttcaattccagcat cgatgctctcgaagtcacat Cxcr4 chemokine (C-X-C motif) receptor 4 NM_009911 199 1493-1691 aaagctagccgtgatcctca caccatttcaggctttggtt Cxcr4 chemokine (C-X-C motif) receptor 4 NM_009911 259 722-980 taatggtgggtctcgtcctg agggcctctgtgatggagat Cxcr6 chemokine (C-X-C motif) receptor 6 NM_030712 185 78-262 GATGATGGGCATCAAGAGTC ATCAGAACCAGGGAGTTTCC Cxcr6 chemokine (C-X-C motif) receptor 6 NM_030712 233 488-720 TGTAGTGGTCCAGGCTACCA TAGTGAGCAATGGCAGGAAG Cxcr6 chemokine (C-X-C motif) receptor 6 NM_030712 187 765-951 CGAAACTTCCAGAAGCACAA TAAGGCAAGCCCGAAAGTAT Cxcr7 chemokine (C-X-C motif) receptor 7 NM_007722 192 599-790 TTGTATGCATCTTGGTGTGG TAGTGAAGGGGACAGCAAAG Cxcr7 chemokine (C-X-C motif) receptor 7 NM_007722 231 1104-1334 CTTCAAGTACTCGGCCAAAA TCACATGCCTTCTCCTCTTC Cxcr7 chemokine (C-X-C motif) receptor 7 NM_007722 220 2020-2239 ATGTGTGCTTTGGGTTTGAA CCTCCCCTGAACTCAAATGT Cxcr7 chemokine (C-X-C motif) receptor 7 NM_007722 153 414-566 GGTCAGTCTCGTGCAGCATA GTGCCGGTGAAGTAGGTGAT Cxcr7 chemokine (C-X-C motif) receptor 7 NM_007722 220 2020-2239 ATGTGTGCTTTGGGTTTGAA CCTCCCCTGAACTCAAATGT Cxcr7 chemokine (C-X-C motif) receptor 7 NM_007722 153 414-566 GGTCAGTCTCGTGCAGCATA GTGCCGGTGAAGTAGGTGAT Cygb cytoglobin NM_030206 196 1800-1995 TAAAGATCTGGCTCCCCTCT TTCTAGGGCTCCACACTGAG Cygb cytoglobin NM_030206 249 1351-1599 TAGAGCATCACGCACACACA GCTGACTCACCCCAACTCTC Cygb cytoglobin NM_030206 155 681-835 TGCATGACCCAGACAAGGTA CGTCTCCACAGGGAAGTCAT Cygb cytoglobin NM_030206 228 816-1043 ATGACTTCCCTGTGGAGACG GGAAGGTCAATGCGTGTCTT Cyp1a1 cytochrome P450, family 1, subfamily a, polypeptide 1 NM_009992 172 182-353 TGCCTTCCATGTATGGACTT GTCAGCATGTGACCAATGAA Cyp1a1 cytochrome P450, family 1, subfamily a, polypeptide 1 NM_009992 186 652-837 GCATCCTCTTGCTACTTGGA GAGCAGCTCTTGGTCATCAT Cyp27a1 cytochrome P450, family 27, subfamily a, polypeptide 1 NM_024264 241 358-598 TCCTTTGGGACTTACACCAA TTAAGGCATCCGTGTAGAGC Cyp27a1 cytochrome P450, family 27, subfamily a, polypeptide 1 NM_024264 195 686-880 TTCTCTACCACCTTGCCTTG TCAGGTATCGCTTCCAAAAG Cyp27b1 cytochrome P450, family 27, subfamily b, polypeptide 1 BC080697 195 1477-1671 CCAGATCTTGACCCATTTTG AGGAGAGTGTGCCTCTTGTG Cyp27b1 cytochrome P450, family 27, subfamily b, polypeptide 1 BC080697 154 2218-2317 TCAGACTGAACCTGGACCAT GAGAGTGGCTGAAGAACCAA Cyp2r1 cytochrome P450, family 2, subfamily r, polypeptide 1 NM_177382 151 533-683 AAGGTGGACCTTTTGACCTC CTGGCAGCTAGTTCCACATT Cyp2r1 cytochrome P450, family 2, subfamily r, polypeptide 1 NM_177382 169 301-469 AAGGAATGCCTTGTTCATCA TTTGGCCACTTCCAAAATAA Cyp2r1 cytochrome P450, family 2, subfamily r, polypeptide 1 NM_177382 250 1192-1441 TCCATTCCTAAAGGCACAAC CATGTGGAAAATGCAAATGA Cyp2r1 cytochrome P450, family 2, subfamily r, polypeptide 1 NM_177382 209 1372-1580 CTGGCTCGAATGGAAATGTT TTGGCCCAAACACCATTATT Dapk1 death associated protein kinase 1 NM_029653 249 577-825 GTTTGACTTCCTGGCTGAGA ACAAACTCTGGTGTCCCAAA Dapk1 death associated protein kinase 1 NM_029653 250 4514-4763 AGCTGTAACAGTGGCACGTC TACGGTCTGCTCTTGACTGG Dapk1 death associated protein kinase 1 NM_029653 193 993-1185 TCTTCCGGAACACCAGTACC TTTTTCCGAGCTGCAAACTT Dapk1 death associated protein kinase 1 NM_029653 161 2746-2906 tgactactttgctgccaacg tcttcagcttgcctccaaat Dapk1 death associated protein kinase 1 NM_029653 180 1482-1661 caaggattgacgtccaggat gttgaaccacatctgcatgg Dapk2 death-associated kinase 2 NM_010019 168 749-916 ATGTGGAGCATTGGAGTCAT AAGCTTCCGAATGAAGTCCT Dcc deleted in colorectal carcinoma NM_007831 249 5850-6098 CCAACCATTCCCCTACTTCT CCTGTGGTCAACATCTGTCA Dcc deleted in colorectal carcinoma NM_007831 168 7345-7512 TGGAACCATGAGACTGGTTT ACACCGTCATAGACCTTGGA Dcc deleted in colorectal carcinoma NM_007831 84 3172-3255 TACAGGCTGTGGCTCTTACC CATCGGATGTTTTCTGGTTC Dctd dCMP deaminase NM_178788 167 1200-1366 TCTCGTTCTTAGCAGGGATG CTCCTCAACCTCATGTGACC Dctd dCMP deaminase NM_178788 154 1343-1496 ACCTGGTCACATGAGGTTGA CAAGGCTAAGAGGCTGGAAC Ddah1 dimethylarginine dimethylaminohydrolase 1 NM_026993 178 499-676 GAAAATGCAACTTTGGATGG CCATGCTGCAGAAACTCTTT Ddah2 dimethylarginine dimethylaminohydrolase 2 NM_016765 206 380-585 GAGGTAAACTGAGGCAACGA CATCTCCACAATTCGGAGTC Ddit3 DNA-damage inducible transcript 3 NM_007837 210 CACACCTGAAAGCAGAACCT ACGCAGGGTCAAGAGTAGTG Ddit3 DNA-damage inducible transcript 3 NM_007837 253 AAACGGAAACAGAGTGGTCA GATGGTGCTGGGTACACTTC Ddit3 DNA-damage inducible transcript 3 NM_007837 219 77-295 CGGAACCTGAGGAGAGAGTG CGTTTCCTGGGGATGAGATA Ddx11 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 NM_001003919 245 854-1098 AGACCCGGCTAGTCTCACTT GTCCTTCACTTCCAGCAGAA Ddx11 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 NM_001003919 113 869-981 CACTTGGCTCTAGGCAGACC GTTCTTTTCGCGTTTGCTTC Ddx11 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 NM_001003919 130 3528-3657 TTGTGTGAGCTTCAGCAACC TGTAAGCGGCACAAGAACTG Defb1 defensin beta 1 NM_007843 242 13-254 CAAGCTCATTCAAGCCTCAT TATTAGATGGGCAGCTGGAG Defb1 defensin beta 1 NM_007843 253 589-841 CGGAATGGAACAGAGAACAC TCCAAGTCCCAACACAGATT Defb1 defensin beta 1 NM_007843 160 61-220 CATCCTCTCTGCACTCTGGA TCCATGTTGAAGGCATTTGT Defb2 defensin beta 2 NM_010030 104 38-141 GGACTCTCTGCTCTCTGCTG GTGGTCAAGTTCTGCTTCGT Defb2 defensin beta 2 NM_010030 165 63-227 ATGCTGCCTCCTTTTCTCAT GGGTTCTTCTCTGGGAAACA Defb2 defensin beta 2 NM_010030 81 147-227 CACCAATGGAGGGTACTGTG GGGTTCTTCTCTGGGAAACA Defb3 defensin beta 3 NM_013756 119 57-175 GTCTCCACCTGCAGCTTTTA GAACTCCACAACTGCCAATC Defb3 defensin beta 3 NM_013756 171 156-326 GATTGGCAGTTGTGGAGTTC TTTTTGCTAGGGAGCACTTG Defb3 defensin beta 3 NM_013756 202 27-228 CCTTCTGTTTGCATTTCTCC TGTTTAACGGGATCTTGGTC Defb3 defensin beta 3 NM_013756 83 237-319 ACCAGAATTTGCTCCTCCAT TAGGGAGCACTTGTTTGCAT Defb3 defensin beta 3 NM_013756 154 166-319 TGTGGAGTTCCTTTCCTCAA TAGGGAGCACTTGTTTGCAT Defb3 defensin beta 3 NM_013756 93 104-196 GTTTGAGGAAAGGAGGCAGA TCTTGCAGCATTTGAGGAAA Defb3 defensin beta 3 NM_013756 108 56-163 TGTCTCCACCTGCAGCTTTT TGCCAATCTGACGAGTGTTG Defb3 defensin beta 3 NM_013756 209 56-264 TGTCTCCACCTGCAGCTTTT CCATCTTCATGGAGGAGCAA Defb3 defensin beta 3 NM_013756 283 39-321 ATTTCTCCTGGTGCTGCTGT GCTAGGGAGCACTTGTTTGC Dennd2a DENN/MADD domain containing 2A NM_172477 204 2695-2898 AGCACTCTGTCCAAATGCTG ATTGATGAGATCGACCACGA Dennd2a DENN/MADD domain containing 2A NM_172477 153 4126-4278 CTGTGAATGCCACCAAAAAC AAGCCTAGGAGCTTGTGGAA Dffa DNA fragmentation factor, alpha subunit NM_001025296 231 250-480 CCATTGATAAGTCCCTGACG CCACATTCTTCCACTTCACC Dffb DNA fragmentation factor, beta subunit NM_007859 191 1685-1875 ACCTGGCATTTGGTTTTGTA CAGTCCAGCCAGAGCTACAT Dgat1 diacylglycerol O-acyltransferase 1 NM_010046 176 418-593 CCAGGTGGTGTCTCTGTTTC AGATGATTGTGGCCAGGTTA Dgat2 diacylglycerol O-acyltransferase 2 NM_026384 209 1844-2052 CCTAGCCCTCTTCTCCAATC GAAGAGAAGCCCTTCCTCAC Dhcr24 24-dehydrocholesterol reductase NM_053272 177 526-702 GTGGAGCCCTTGGTGTCTAT CTCGTAGGCAGTGCAAATGT Dhcr24 24-dehydrocholesterol reductase NM_053272 179 1489-1667 ATGAGGCAGCTGGAGAAGTT GCCTTGCAGATCTTGTCGTA Dhcr24 24-dehydrocholesterol reductase NM_053272 229 935-1163 GGTTGCTGTACTCCCTGGAT AAAGGGATGATGTCCTGGAG Dhcr24 24-dehydrocholesterol reductase NM_053272 243 3682-3924 CACTCAGCTGCTATGGGACA AGGGATTCATGCCTTCTCCT Dhcr7 7-dehydrocholesterol reductase NM_007856 189 139-327 GAAGTTGAGGCAGGAACTGA GCTTGTCTGTGGAGCATTTT Dhcr7 7-dehydrocholesterol reductase NM_007856 245 789-1033 ACTGTATGCCTTGTGGGTCA AGGGGATCCAGTTGTCAAAG Dhcr7 7-dehydrocholesterol reductase NM_007856 171 2014-2184 TCCTCAGTTTGCTCATCTGG AATAGATGGTGGGCTCCAAG Dhcr7 7-dehydrocholesterol reductase NM_007856 233 531-763 CGCTCCCAAAGTCAAGAGTC GTGTCTTGGCCCAAATGTCT Diablo diablo homolog NM_023232 234 687-920 CACCAGAAAGCACAGGAAGT AGAGGGTGTGAGCAGACAAG Diablo diablo homolog NM_023232 238 180-417 actggatttggcatgacact gggaattcatcttcccaagt Diablo diablo homolog NM_023232 162 547-708 ctgcctatcaaactggagca tcacttcctgtgctttctgg Dio1 deiodinase, iodothyronine, type I NM_007860 231 53-283 CTGAAGCGGCTTGTGATATT AGCCCTGTCTTCCAGTCTCT Dio1 deiodinase, iodothyronine, type I NM_007860 221 1030-1250 AGACCAATCCAGAGTGTCCA TCCAATGCCTATGGTTCCTA Dio1 deiodinase, iodothyronine, type I NM_007860 187 338-524 TGCAACATCTGGGATTTCAT TCTTAAAAGCCCAGCCATCT Dio1 deiodinase, iodothyronine, type I NM_007860 236 462-697 CAGCCGATTTCCTCATCATT GATCCTGCCCTCCTGTATCA DIO3 deiodinase, iodothyronine type III NM_172119 215 1344-1558 GTCCTGCTGCTTTTGTGTTT GAGCACTCTCCCCCTCTTAC DIO3 deiodinase, iodothyronine type III NM_172119 226 891-1116 CATGGTACTAGGCCACATCG GAGCAAGCCAAAAACGTACA DIO3 deiodinase, iodothyronine type III NM_172119 154 1464-1617 ATGACGAACCGCCTCTAACT GTCCATCCCTTACCATGTCC DIO3 deiodinase, iodothyronine type III NM_172119 152 1102-1253 GTTTTTGGCTTGCTCTCAGG CAACAAGTCCGAGCTGTGAA DIO3 deiodinase, iodothyronine type III NM_172119 210 1229-1438 AGCATTTCACAGCTCGGACT AAAGCTAGGCGGGGAAATTA Dlg2 discs, large homolog 2 NM_011807 218 2402-2619 AGAAGCTGGCCAGTACAATG TCTTGGCTTGTTCCTCTGTC Dlg2 discs, large homolog 2 NM_011807 219 6301-6519 TCAACAGAGGCAAACTCTGG GGAATTTTAGGCAGGACCAA Dlg2 discs, large homolog 2 NM_011807 197 1201-1397 ACTCACCAATTCCCAAGCAC CATGTCAGAGTCAGGGAGCA Dnm2 dynamin 2 NM_001039520 152 1425-1576 TGAAGTGTGTTGACCTGGTG AATCTGGTCCTTGGTTCTCC Dram damage-regulated autophagy modulator NM_027878 224 2012-2235 CCTCCTTTGGCTGCTAAGTG CCAGCTTCCACAGGAAATGT Dram damage-regulated autophagy modulator NM_027878 160 1483-1642 AATGTGGAAGACCTCGGTTC TCACAGAGAAGGGCAGTTTG Dram damage-regulated autophagy modulator NM_027878 217 1053-1269 AGCACCAACGACACTGTAGC ATATGCCCTGATTTGGCTTC Dusp11 dual specificity phosphatase 11 NM_028099 238 2288-2525 GGGACAGGTACAGAATGCAC GACAGAAGCCAGACGAGTGT Dusp11 dual specificity phosphatase 11 NM_028099 216 1772-1987 GGTTGAACAGACATCCTTGG GCAAAAACTTGCTGTGGACT E2f1 E2F transcription factor 1 NM_007891 202 599-800 CGCATCTATGACATCACCAA GTTGCAGCTGTGTGGTACAG E2f1 E2F transcription factor 1 NM_007891 211 1374-1584 ACTGTGACTTTGGGGACCTG CCCATTTTGGTCTGCTCAAT E2f1 E2F transcription factor 1 NM_007891 197 1196-1392 GTCCCTATGGAAGAGGACCA AGGTCCCCAAAGTCACAGTC E2f2 E2F transcription factor 2 NM_177733 231 966-1196 GTGGGTAGGCAGGGAACTAT GCAATCACTGTCTGCTCCTT E2f4 E2F transcription factor 4 NM_148952 151 929-1079 AAGTCAGCTCACTCCCACTG GGCTCAAAGGAGGTAGAAGG E2f4 E2F transcription factor 4 NM_148952 152 1471-1622 CTGGCACTTGTGACTGTGCT AGCACCACCCTCTCTCTGAA E2f4 E2F transcription factor 4 NM_148952 235 765-999 CAAGCCTGCCTTAGCTCAAC ATCCAGCAGTGCAGAGGACT Ebp phenylalkylamine Ca2+ antagonist binding protein NM_007898 206 291-496 GGGAACTGATTGGTTGCCTA GGCTGAGACCAAGTCAGGAG Ebp phenylalkylamine Ca2+ antagonist binding protein NM_007898 203 711-913 GGGTTTTTCTGTCCCTTTGT CAGCCACGTGATCACAATTA Ebp phenylalkylamine Ca2+ antagonist binding protein NM_007898 168 1247-1414 TACGGGGATGTGCTGTACTT CTGGGCACTAGTGAGATGCT Ebp phenylalkylamine Ca2+ antagonist binding protein NM_007898 202 1342-1543 CCTGAATGCTGTATGGTTGG GCGAGGAGGAAGAAGATTTG Edaradd EDAR-associated death domain NM_133643 231 1613-1843 CCCAGGTATATGGGCTCTTT TCTGGTCCCATGCTTTATGT Edaradd EDAR-associated death domain NM_133643 166 2193-2298 TTAAAATGCCCTTTGGGAAG GGGTCTCTCCCTGAACAAAA Edaradd EDAR-associated death domain NM_133643 282 466-747 CTGCTCGGACACTCATCTGT TTCTGCTGACACCTGAAAGG Egfr epidermal growth factor receptor NM_207655 162 1650-1811 GTGATGGGGATGTGATCATT AGCATAAAGGATTGCAGACG Egln3 EGL nine homolog 3 NM_028133 157 1754-1910 AATTCAGCACTGGATTCTGC CCGTTAAAGGGAACACACAC Egr1 early growth response 1 NM_007913 216 CCATGTCCAAGTTCTTCACC ACCCCAAGGAAAACAAAATC Egr1 early growth response 1 NM_007913 193 AAGCACAGGAGGGAAGAGAT GGTGAAGAACTTGGACATGG Egr1 early growth response 1 NM_007913 195 869-1063 ACAGCAGTCCCATCTACTCG CTCCCTGTTGTTGTGGAAAC Egr1 early growth response 1 NM_007913 195 869-1063 ACAGCAGTCCCATCTACTCG CTCCCTGTTGTTGTGGAAAC Egr2 early growth response 2 NM_010118 182 855-1036 CACCACCTCCTCCTCCTTAT TCCAGGATAGTCTGGGATCA Egr2 early growth response 2 NM_010118 195 1656-1850 AGTCTTCAGCCTCTGGTCCT GAACAGGGAAGGGTGGTAGT Egr2 early growth response 2 NM_010118 244 322-565 GAGTTGGGTCTCCAGGTTGT CAGGGGTCTCTTCTCTCCAG Eif4ebp1 eukaryotic translation initiation factor 4E binding protein 1 NM_007918 237 243-479 ACCGGAAATTTCTGATGGAG CTTGGGGGACATAGAAGCAT Eif4ebp2 eukaryotic translation initiation factor 4E binding protein 2 NM_010124 236 704-939 CCAGTCCACAGAAGAAAGCA TCCAGAGCTGAGGACAAATG Eif4g1 eukaryotic translation initiation factor 4, gamma 1 NM_145941 153 4783-4935 CTGCTTCGGATGTTCTTTGA CTCACGAAGCCAATTGAAGA Elk1 ELK1, member of ETS oncogene family NM_007922 184 1476-1659 GAAGCCATGACTACCACCAC AGTTGTCTGTTTTGGGTGGA Enpp3 ectonucleotide pyrophosphatase/phosphodiesterase 3 NM_134005 170 1385-1554 GTCGAAAACCTGACCAACAC GTAGCCATGTGTTCCTCCAC Enpp3 ectonucleotide pyrophosphatase/phosphodiesterase 3 NM_134005 187 978-1164 TGTCCCATATGAAAGGAGGA CTCCATCAACATTCCAAAGG Enpp3 ectonucleotide pyrophosphatase/phosphodiesterase 3 NM_134005 195 2408-2602 CTGGCACTGATGTCCCTATC GTGCTTGGAACCTCTCTTCA Epo-6 Erythropoietin NM_007942 190 308-497 AATGGAGGTGGAAGAACAGG CTTCTGAGCTCCCAGTACCC Epo-7 Erythropoietin NM_007942 124 504-627 ATGTCGCCTCCAGATACCAC CCTCTCCCGTGTACAGCTTC Epo-8 Erythropoietin NM_007942 124 91-214 CCACCCTGCTGCTTTTACTC GCCTCCTTGGCCTCTAAGAT Epo-9 Erythropoietin NM_007942 288 234-521 TGTGCAGAAGGTCCCAGACT GGTATCTGGAGGCGACATCA Eps15L1 epidermal growth factor receptor pathway substrate 15-like 1 NM_007944 245 1862-2106 AACTCCCAGGAACTTCATCC AAGGGGTCTGAGGTAAATGG Eps15L1 epidermal growth factor receptor pathway substrate 15-like 1 NM_007944 242 364-605 ACTGATGGCCACACAGTCAT AGTGCATAGCCACAGCAAAC Eps15L1 epidermal growth factor receptor pathway substrate 15-like 1 NM_007944 194 1129-1322 TCCCATTCCAGACAGTTCAA CCCGGTCTAGGTCATTTTGT Erbb2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2 NM_001003817 168 990-1157 GCCCTCATCACCTACAACAC CTCAGCTGTGACCTCTTGGT Esr1 estrogen receptor 1 (alpha) NM_007956 212 2208-2419 TTCTCCCTTTGCTACGTCAC ATCGCTTTGTCAACGACTTC Esr1 estrogen receptor 1 (alpha) NM_007956 232 3392-3623 CCAGAATTGGGTCATGAGAG AGAAGCCTAGCCATTCACCT Esr1 estrogen receptor 1 (alpha) NM_007956 250 1304-1553 AATCTCCATGATCAGGTCCA GCAAAATGATGGATTTGAGG Esr1 estrogen receptor 1 (alpha) NM_007956 211 926-1136 TGTTACGAAGTGGGCATGAT TCTGGTCAGCTGTCAAGGAC Esr2 estrogen receptor 2 (beta) NM_207707 185 2413-2597 TGGTCATCAAATCGACCTTT GGAACAAGGTCACATCCAAG Esr2 estrogen receptor 2 (beta) NM_207707 186 881-1066 TCATTACGGTGTCTGGTCCT CTCCTGGATCCACACTTGAC Esr2 estrogen receptor 2 (beta) NM_207707 244 1859-2102 CATCAGTAACAAGGGCATGG ACATGTCCCACTTCTGACCA Esr2 estrogen receptor 2 (beta) NM_207707 203 2767-2969 CACAGCTTCAGGCCTTCATA CTTGAGATCAACTCCCAGCA Ets2 E26 avian leukemia oncogene 2, 3' domain NM_011809 188 2764-2951 CAGCCTTGACCTTAAACGAA CTGGTCCAAGACACCATTTC F2 coagulation factor II NM_010168 213 439-651 CCTGAAATCAACTCCACCAC TGGAGGTGACAGATTGTCCT F2 coagulation factor II NM_010168 212 343-554 TGTGCTATGGATCTGGGTGT CTGCGCACAGTAGGATCTGT F2r coagulation factor II (thrombin) receptor NM_010169 225 1033-1257 GCATCTTCATCGTCTGCTTT TGGGATCAGAGCTTTCTTTG F2r coagulation factor II (thrombin) receptor NM_010169 188 2075-2262 AGCCTAGACACAGCCATCTG TCCCAAGATGGCATACCTTA F2r coagulation factor II (thrombin) receptor NM_010169 255 895-1149 TCTCCGCCATCTTCTTTCTT CACAGACGCAGAGGAGGTAA F2rl3 coagulation factor II (thrombin) receptor-like 3 NM_007975 162 36-197 CTGCTGTATCCTTTGGTGCT TGGATTAGGCTTGTCTGAGG F2rl3 coagulation factor II (thrombin) receptor-like 3 NM_007975 151 1403-1553 CTAGGGAGGTGGAGAAGAGG GGGAAACTCCATTCTGGTTT F2rl3 coagulation factor II (thrombin) receptor-like 3 NM_007975 208 704-911 GCAGACCTTCCGATTAGCTG CAGTCTGAGTGCATGGCTGT F3 coagulation factor III NM_010171 174 AAAATAGCCCAGGAAGCAGT GGGTGTTCTTCCCTTTCTGT F3 coagulation factor III NM_010171 180 AGTGCTTCTCGACCACAGAC GTAAAAACTTTGGGGCGTTT F3 coagulation factor III NM_010171 246 CAGTGGACAGATGCCTTTCA AATCACAAAGATGCCCCAAG F3 coagulation factor III NM_010171 241 CACCGAGCAATGGAAGAGTT ATGTTGCACAGTTCCCATCA F3 coagulation factor III NM_010171 220 GGGACAGAAAGGGAAGAACA CGTCCTAACGTGACAAATGC F3 coagulation factor III NM_010171 204 1181-1385 TTCATGGCCTGTTACTCCAG AAGCCCACCCAGGTTATATG F3 coagulation factor III NM_010171 173 AGCAATGGAAGAGTTTCCTG GCTTCAGCCTTTCCTCTATG F3 coagulation factor III NM_010171 194 1348-1543 AGTGGACAGATGCCTTTCAT GAAAGTTTGCCACTTGCTTT Fabp1 fatty acid binding protein 1 NM_017399 179 88-266 CCATTCATGAAGGCAATAGG CCAGTCATGGTCTCCAGTTC Fabp1 fatty acid binding protein 1 NM_017399 181 31-211 GTTGCCACCATGAACTTCTC CTTTGGGTCCATAGGTGATG Fabp1 fatty acid binding protein 1 NM_017399 250 8-257 GTCAGCTGTGGAAAGGAAGC GTCTCCAGTTCGCACTCCTC Fadd Fas (TNFRSF6)-associated via death domain NM_010175 226 1146-1371 CCTCCATGGTGGTCTGTAAG GGGAGGGATTTCTGAGGTTA Fam19a2 family with sequence similarity 19, member A2 NM_182807 182 2093-2274 AATACTGATGGCTGGGTTCA GGACCCAACGTTCACTGTAG Fam19a2 family with sequence similarity 19, member A2 NM_182807 167 3695-3861 ACCTTTGGTGGGAAGAACAG CACGTAGAACCACCCAGTTG Fam19a2 family with sequence similarity 19, member A2 NM_182807 239 1478-1716 GGACGTGGAAATAAGCTGGT TTCCTTGTGTTGCTTTCTGC Fas Fas (TNF receptor superfamily member) NM_007987 168 972-1139 AGGACCTTGGAAAATCAACC GAGAACACACCAGGAGTTGC Fas Fas (TNF receptor superfamily member) NM_007987 255 248-506 GAGGACTGCAAAATGAATGG CTCAAGGGTTCCATGTTCAC Fasl Fas ligand (TNF superfamily, member 6) NM_010177 191 1222-1412 CATGGAGTGGTCCTTAATGC AAGTAGACCCACCCTGGAAG Fasl Fas ligand (TNF superfamily, member 6) NM_010177 252 Not ordered GAGTGTGGCCCATTTAACAG TTCTCCTCCATTAGCACCAG Fat1 FAT tumor suppressor homolog 1 NM_001081286 245 4171-4415 ATGCCTCTGTGGTTTGACAT TCCTCAGGAACAGCAACTTC Fat1 FAT tumor suppressor homolog 1 NM_001081286 150 3058-3207 TATGTGGAAGTGGAGGTCGT GTCTCTGCCTGTGTCTTCGT Fat1 FAT tumor suppressor homolog 1 NM_001081286 202 12300-12501 TCCCTGTAAGAATGGTGGAA CTCACAGTGCTTCCCTCTGT Fcgrt Fc receptor, IgG, alpha chain transporter NM_010189 241 290-530 CCTGGTCTACGAAGAGTCCA GTAGCCCAGAAAGAGGGAAG Fcgrt Fc receptor, IgG, alpha chain transporter NM_010189 221 853-1073 GAGACGGAAATCGTTGCTAA GGTGGGTAGAAGGAGAAAGC Fcgrt Fc receptor, IgG, alpha chain transporter NM_010189 227 536-762 GGTTGGGTCCTCAGCAGTAT ATTATCCGAGGCCAGTTCAC Fgf20-3 fibroblast growth factor 20 NM_030610 152 405-556 TGAATGCATCTTCAGGGAAC TTTGACGTCTTTTGGACCTG Fgf20-4 fibroblast growth factor 20 NM_030610 275 265-539 CGGCAGGATCACAGTCTCTT CTGGCACCATCTCTTGGAGT Fgf20-5 fibroblast growth factor 20 NM_030610 187 407-593 AATGCATCTTCAGGGAACAA TCTGGGTCTACTGGTCTTGG Fgf20-6 fibroblast growth factor 20 NM_030610 125 408-532 ATGCATCTTCAGGGAACAAT CATCTCTTGGAGTTCCATCC Fgfr1 fibroblast growth factor receptor 1 NM_010206 175 2992-3166 AGTTGGTGGAAGACCTGGAC AGACAGGGCTCCTCAGGTAA Fgfr1 fibroblast growth factor receptor 1 NM_010206 211 4361-4571 CCCAAACCCTAGACCCTGTA AGTTGACCCCAACCAAAGAG Fgfr1 fibroblast growth factor receptor 1 NM_010206 216 1261-1476 AGACGGTGAAGTTCAAGTGC GGTAGGTGTGGTTGATGCTC Fgfr1 fibroblast growth factor receptor 1 NM_010206 164 1808-1971 ATGGTTGACCGTTCTGGAAG GGAAGTCGCTCTTCTTGGTG Fgfr2 fibroblast growth factor receptor 2 NM_010207 213 3399-3611 CACCAACTGCACCAATGAAC GAATCGTCCCCTGAAGAACA Fgfr2 fibroblast growth factor receptor 2 NM_010207 202 1698-1899 CACCGAGAAGATGGAGAAGC GTCTGACGGGACCACACTTT Fgfr2 fibroblast growth factor receptor 2 NM_010207 237 1398-1634 AGAGTTGCAGTGCATGTTGA GTGTCGTCCTCATCATCTCC Fgfr2 fibroblast growth factor receptor 2 NM_010207 223 2230-2452 GATGCTGGGGAATATACGTG TGAAGTCTGGCTTCTTGGTC Fgfr3 fibroblast growth factor receptor 3 NM_008010 194 2654-2847 GTTCACCCATGACCTGCTAC AACACGCAGGAAGTCTTGTC Fgfr3 fibroblast growth factor receptor 3 NM_008010 208 3328-3535 TGGAAAAAGGCAAAGTTGAG TGCAATACCCTGGGACTAAA Fgfr3 fibroblast growth factor receptor 3 NM_008010 217 1616-1832 GCTGTCCTCAGGAGAAGGTC CGCATCATCTTTCAGCATCT Fgfr3 fibroblast growth factor receptor 3 NM_008010 181 926-1106 CTTGGTCATGGAAAGTGTGG CTCCACGTCACTGCCTAGAA Fgfr4 fibroblast growth factor receptor 4 NM_008011 162 1604-1765 CAGAGGCCTTTGGTATGGAT CCAGCAGGTTGATGATGTTC Fgfr4 fibroblast growth factor receptor 4 NM_008011 194 2014-2207 ACCGAGGATGATGTGATGAA AGGGTGAAGATTTCCCACAG Fgfr4 fibroblast growth factor receptor 4 NM_008011 181 1792-1972 TACGTGATTGTGGAATGTGC TCCGAGACTCCAGATACTGC Fgfr4 fibroblast growth factor receptor 4 NM_008011 188 2759-2946 TCTGTTCCAGCCTTATGCTC CTAGGTTGTTTGGGGGAACT Fkbp15 FK506 binding protein 15 BC137706 211 2950-3160 GTGCTGCCAGAACAGGTAGT CTGGAGGTTTAGGTGGGATT Flt1 FMS-like tyrosine kinase 1 NM_010228 163 3289-3451 TTCTGTCCTCCAGAAAGTGC ATCCATTTTAGGGGAAGTCG Flt1 FMS-like tyrosine kinase 1 NM_010228 202 5532-5733 GGTCTAATGACGATGGCAAC CCAAAGCAGCTATTCATCGT Flt1 FMS-like tyrosine kinase 1 NM_010228 209 4601-4809 ATGCACTGACCTGCTCTGTC GGAAACGTCCCTCATGTTCT Flt1 FMS-like tyrosine kinase 1 NM_010228 Fn1 fibronectin 1 NM_010233 167 gacagttggtcaccctgttc tgactttcctgctcaaggtc Fos FBJ osteosarcoma oncogene NM_010234 187 140-326 ATGATGTTCTCGGGTTTCAA TGGGGATAAAGTTGGCACTA Fos FBJ osteosarcoma oncogene NM_010234 231 628-858 TACACTCCAAGCGGAGACAG GTGAAGGCCTCCTCAGACTC Fos FBJ osteosarcoma oncogene NM_010234 151 90-240 ACCAGTGTCTACCCCTGGAC GCTGGGGAATGGTAGTAGGA Fosb FBJ osteosarcoma oncogene B NM_008036 239 3131-3369 TTTATCCCTTTCCTGGTTCC ACTGTCTCCAACAGCCAGAG Fosb FBJ osteosarcoma oncogene B NM_008036 200 1885-2084 CCCCTCCTGCATATCTTTGT GTCATTTCCTCGTTGGGTCT Fosb FBJ osteosarcoma oncogene B NM_008036 176 1647-1822 AAAACAAACAAACCCGCAAG AGAAAACCAGAGACGGAGCA Foxd3 forkhead box D3 NM_010425 226 2047-2272 TGGGAGGGACATTCTTTGTA AATGACACTTCGCCTTTTTG Foxd3 forkhead box D3 NM_010425 175 727-901 ACTCTTACATCGCGCTCATC ATCTTGACGAAGCAGTCGTT Foxd3 forkhead box D3 NM_010425 235 1953-2187 GTCCGCTGGGAATAACTTTC CGCAGAGTGAACCTTCAAAA Foxd3 forkhead box D3 NM_010425 175 75-249 cgtagagaagcgtcgaggac ggcaaaggaggtgtgagtgt Foxd3 forkhead box D3 NM_010425 125 1810-1934 atcctggtccatctgtcctg gccagcttaggtgagtgagg Foxd3 forkhead box D3 NM_010425 123 1315-1437 tgcagctacagctcaacacc tgttctcgatgctgaacgac Foxo1 forkhead box O1 NM_019739 189 TTACCATTGCGGAAAGAGAG AACTGCCCATGATTCACACT Foxo1 forkhead box O1 NM_019739 271 TCAGATCCTGGAGTGCTTTC TCACTGGCTACTTGGCTCTC Foxo1 forkhead box O1 NM_019739 212 1561-1773 TCTCGTCCCCAACATCTTTA TCCTCCGTAACTTGATTTGC Foxo1 forkhead box O1 NM_019739 218 4301-4518 TCATAGGCTTCCCACCATAA CTTTCCGCAATGGTAAGAAA Foxo3a forkhead box O3a NM_019740 197 2253-2449 CCCTCATCTCCACACAGAAC TCACTGTCCACTTGCTGAGA Foxo3a forkhead box O3a NM_019740 237 1862-2098 GATCCAATGATGTCCTTTGC CAGTGAGGAGCCTGAGAGAG Foxo4/Mllt7 myeloid/lymphoid or mixed lineage-leukemia translocation to 7 homolog NM_018789 183 1736-1919 GTGCGACATGGATAACATCA AGTAGGGTCCCAAACTCCTG Foxo4/Mllt7 myeloid/lymphoid or mixed lineage-leukemia translocation to 7 homolog NM_018789 207 CGAAATCGAGAAGAAGCTGA GAGATTGAGCCCATCCAGTA Foxp3 forkhead box P3 NM_054039 203 2630-2832 TCTCCAGGTTGCTCAAAGTC GCAGAAGTTGCTGCTTTAGG Foxp3 forkhead box P3 NM_054039 240 745-984 GAGCCAGCTCTACTCTGCAC CTCCAGAGACTGCACCACTT Foxp3 forkhead box P3 NM_054039 178 3192-3369 ATGCAGGGCAGCTAGGTACT AGCTTTGCTCTGTGGAGGAT Foxp3-4 forkhead box P3 NM_054039 139 745-883 GAGCCAGCTCTACTCTGCAC CCTCGAAGACCTTCTCACAA Foxp3-5 forkhead box P3 NM_054039 298 1086-1383 GAGCTCTTGCTGCATCGTAG TCTGAAGTAGGCGAACATGC Foxp3-6 forkhead box P3 NM_054039 225 546-770 GGACAGACCACACTTCATGC GGGAAGGTGCAGAGTAGAGC Frap1 FK506 binding protein 12-rapamycin associated protein 1 NM_020009 193 5809-6001 GAGTCCTCACCCTGTGGTTT GGGTGGTACCGACCAATATC Frap1 FK506 binding protein 12-rapamycin associated protein 1 NM_020009 223 1875-2097 TTTGAAGGCCACTCTCTGAC CAGGATCTGTTATGCCAACC Frs2 fibroblast growth factor receptor substrate 2 NM_177798 191 318-508 GGCCAGATCTAGTGCTCACA TTTCCGGGTGTACAGAATCA Frs2 fibroblast growth factor receptor substrate 2 NM_177798 173 460-632 TGGTGTGATGGAACTCACAG GGGCACACTTAAAAGCAAAA Frs2 fibroblast growth factor receptor substrate 2 NM_177798 195 3017-3211 CTTTAGCAGGGGTTGTCTCA TCTGAGTGGCCTTTCTTCAC Frs3 fibroblast growth factor receptor substrate 3 NM_144939 191 134-324 CCAAGGACAAGGGGACTAAA ACCCCTTCATCATCCACATT Gabarap gamma-aminobutyric acid receptor associated protein NM_019749 213 636-848 ACCAGGAACACCATGAAGAA GACTGGAGAGACAGCCTCAA Gabarapl1 gamma-aminobutyric acid (GABA(A)) receptor-associated protein-like 1 NM_020590 180 1081-1260 CCCCTAACCTCTGTCTCCAT GTTTAATGCCATCCAAAACG Gabarapl1 gamma-aminobutyric acid (GABA(A)) receptor-associated protein-like 1 NM_020590 167 1159-1325 GCAGGAGACATTCGAACAGA GAGGCTCCTGAAAGTCCAAG Gabarapl1 gamma-aminobutyric acid (GABA(A)) receptor-associated protein-like 1 NM_020590 191 350-540 TCGTGGAGAAGGCTCCTAAA ATACAGCTGGCCCATGGTAG Gabarapl2 gamma-aminobutyric acid (GABA(A)) receptor-associated protein-like 2 NM_026693 237 108-344 TGGATGTTTAAGGAGGACCA GTCCACAAACAGGAAGATGG Gabarapl2 gamma-aminobutyric acid (GABA(A)) receptor-associated protein-like 2 NM_026693 235 208-442 TCTCGGGCTCTCAGATTGTT GTGTTCTCTCCGCTGTAGGC Gabarapl2 gamma-aminobutyric acid (GABA(A)) receptor-associated protein-like 2 NM_026693 177 135-311 GAACACAGATGCGTGGAATC AAGCTGGATCCTTTTCCTGA Gabra1 gamma-aminobutyric acid (GABA) A receptor, subunit alpha 1 NM_010250 159 1087-1245 TTCAAAGGACCCATGACAGT GTACAGCAGAGTGCCATCCT Gabra1 gamma-aminobutyric acid (GABA) A receptor, subunit alpha 1 NM_010250 202 281-482 CCCCAAAATAGAGGAATGCT GATGTGAAATAGGCGGTGAC Gabra1 gamma-aminobutyric acid (GABA) A receptor, subunit alpha 1 NM_010250 171 2820-2990 CCCTTTCAATGGGCTACACT CTTGGGTGAATGGGCTATCT Gadd45a growth arrest and DNA-damage-inducible 45 alpha NM_007836 231 808-1038 GATGACTTTGCAGAGGGAGA TGAGGGCATAAAGACCAAAA Gapd glyceraldehyde-3-phosphate dehydrogenase NM_008084 223 543-765 AACTTTGGCATTGTGGAAGG ACACATTGGGGGTAGGAACA Gapd-3 glyceraldehyde-3-phosphate dehydrogenase NM_008084 171 193-363 ACTCCACTCACGGCAAATTC TCTCCATGGTGGTGAAGACA Gapd-4 glyceraldehyde-3-phosphate dehydrogenase NM_008084 183 654-836 CAGAACATCATCCCTGCATC CTGCTTCACCACCTTCTTGA Gata1 GATA binding protein 1 NM_008089 220 661-880 CTTGTGAGGCCAGAGAGTGT CTCCGCCAGAGTGTTGTAGT Gbl G protein beta subunit-like NM_019988 153 2385-2537 TTGCTCTGAAACGGAGTCAC GGTTAAGGCTGAATCCCAAA Gbp2 guanylate binding protein 2 NM_010260 172 589-760 ACCAGCTGCACTATGTGACG TCAGAAGTGACGGGTTTTCC Gbp2 guanylate binding protein 2 NM_010260 157 248-404 GGCTCTGAGGATCCTGTCTG GATGCCCTTGGTGTGAGACT Gbp2 guanylate binding protein 2 NM_010260 209 1044-1252 AAGAGCCTGGTGCAGACCTA TCACTCTCAATTGGCCTGTG Gfi1 growth factor independent 1 NM_010278 163 2283-2445 GAAGAAGGGGACTTGGTGAT GCTCTCCCATACCTAGCACA Gfi1 growth factor independent 1 NM_010278 233 2070-2302 CTCACAGGCCAGAATGAACT ATCACCAAGTCCCCTTCTTC Gfi1 growth factor independent 1 NM_010278 202 AAATGCAGCAAGGTGTTCTC TGGATGACCTCTTGAAGCTC Gfi1b growth factor independent 1B NM_008114 210 134-343 CCACGGTCCTTTCTAGTGAA GCTCTGGTTCAGCAACATCT Gja1 gap junction protein, alpha 1 NM_010288 187 157-343 ACTTCAGCCTCCAAGGAGTT CAGGAGCAGGATTCTGAAAA Gli1 GLI-Kruppel family member GLI1 NM_010296 159 2327-2485 CATGGATTTTTCCTCCACTG TCAGGATAGGAGACCTGCTG Gli1 GLI-Kruppel family member GLI1 NM_010296 177 2938-3114 CATACCAGAGCCCCAAGTTT TGTTTACTCCCACGGTGAAA Gli1 GLI-Kruppel family member GLI1 NM_010296 249 376-624 CTCCTCCTCGGAGTTCAGTC GGACTCCATAGGGAGGTGAA Gli2 GLI-Kruppel family member GLI2 NM_001081125 200 6176-6375 CACCACAGACATGTGCGTAT CATTTGGAGTTGGTCCTGTC Gli2 GLI-Kruppel family member GLI2 NM_001081125 185 1155-1339 ATGGACATCTGTCTGCTGGT GATGGAGGTGAGAGTCATGG Gli2 GLI-Kruppel family member GLI2 NM_001081125 245 4292-4536 AACCTTCTGTCATCCCATCA GGCTGAGGAGCTAGGGATAC Glp1r glucagon-like peptide 1 receptor NM_021332 197 718-914 CGTGGCAGCCAACTACTACT TGGAGTTCCTAGTCCAGCAG Glp1r glucagon-like peptide 1 receptor NM_021332 240 544-783 CATCCACCTGAACCTGTTTG GAGAAGGCCAGCAGTGTGTA Glp1r glucagon-like peptide 1 receptor NM_021332 240 893-1132 GGCTGCTGGACTAGGAACTC GTGTTCGTCCATCACAAAGG Glp1r glucagon-like peptide 1 receptor NM_021332 210 325-534 AGCTGAGGGTCTCTGGCTAC GTGCAGTGCAAGTGTCTGAA Glp1r glucagon-like peptide 1 receptor NM_021332 205 394-598 GTCTAAGCGAGGGGAGAGAA GATGAAGACGGACAGTGCTC Gnai3 guanine nucleotide binding protein (G protein), alpha inhibiting 3 NM_010306 172 229-400 CGCTGGAGAATCTGGTAAAA TTCCCCAAAATCAATCTTCA Gpsm1 G-protein signalling modulator 1 NM_153410 239 2612-2850 ACTCTGATCTGCCTCACGAC CCTCATGAACGTCCACTACC Gpsm1 G-protein signalling modulator 1 NM_153410 240 2734-2973 ACTTGGCCTTTGAGGAAAGA TACAGTGCCCTGTGTCCAAT Gpsm1 G-protein signalling modulator 1 NM_153410 219 3076-3294 TGGAGGGCTCTGTACAACTG CATGAACAACATGGCAAACA Gpsm2 G-protein signalling modulator 2 NM_029522 231 1280-1510 TCGAAACTGCTTCCGAATAC GAGCTGTGTATGCGTTTCCT Gpsm3 G-protein signalling modulator 3 NM_134116 189 612-800 TCACCAGTCCCTTCTCTCTG GTTGTGTCCACCCTACCTTG Gramd1b GRAM domain containing 1B NM_172768 188 2188-2375 GGCTAGCAAGTCTTCAGCAG GGTGAAAACCATCAGGAGTG Gramd1b GRAM domain containing 1B NM_172768 193 543-735 ACGAAAGCACTGCCAGTAAC CCAGACTGTGAGGAGCAACT Gramd1b GRAM domain containing 1B NM_172768 175 784-958 GCTAAGCCCCACTTACAAGC GCGGAAGATGTTGCTGTAGA Grb2 growth factor receptor bound protein 2 NM_008163 233 1835-2067 TCTCGAAGCCTCAGCTTTTA GGAAATACGAGCGTGAAAAA Grin1 glutamate receptor, ionotropic, NMDA1 (zeta 1) NM_008169 174 2301-2474 GGAGTTTGAGGCTTCACAGA CGAACCCATGTCTTATCCAG Grin1 glutamate receptor, ionotropic, NMDA1 (zeta 1) NM_008169 224 1980-2203 TCGTATCCTAGGCATGGTGT GGTACATGGTGCTCAACTCC Grin1 glutamate receptor, ionotropic, NMDA1 (zeta 1) NM_008169 150 1319-1468 TGTATGTCAAGCCCACAATG AGAAGCCATAACAGCACTGG Grin1 glutamate receptor, ionotropic, NMDA1 (zeta 1) NM_008169 186 382-567 ACTCCCAACGACCACTTCAC GTAGACGCGCATCATCTCAA Grin1 glutamate receptor, ionotropic, NMDA1 (zeta 1) NM_008169 156 252-407 CGGCTCTTGGAAGATACAGC GTGGGAGTGAAGTGGTCGTT Grin1 glutamate receptor, ionotropic, NMDA1 (zeta 1) NM_008169 180 537-716 CAGCGTCTGGTTTGAGATGA AGCAGAGCCGTCACATTCTT Gstm1 glutathione S-transferase, mu 1 NM_010358 185 390-574 CGATGGATCACACAAGATCA CTGGCTTCTGCTTCTCAAAG Gstm1 glutathione S-transferase, mu 1 NM_010358 213 1014-1226 CTTCCCAGTCAAGTCCACAC CAGGCTGGCACTCAAGTATT Gstm1 glutathione S-transferase, mu 1 NM_010358 184 948-1131 GTGGCTCCTGGTTCTCTCTC TCAGGACAGACCTCAGTTCG Gstm1 glutathione S-transferase, mu 1 NM_010358 159 17-175 GGTCTGCTGCTCTGGTTACA AAACTGGCTTCAGCAGGACT Gstm2 glutathione S-transferase, mu 2 NM_008183 237 210-446 actttcccaatctgccctac tcttctcagggagaccctct Gstm2 glutathione S-transferase, mu 2 NM_008183 165 787-951 ttccctattcctccatttcc ggggattctcgggtctagta Gstm2 glutathione S-transferase, mu 2 NM_008183 179 213-391 ttcccaatctgccctacttg gtagcaaaccatggccaact Gtf2h1 general transcription factor II H, polypeptide 1 NM_008186 157 1734-1890 AGAAAAGATTCGGAGGCAGT TTTCAACCCACAAAACCTGT Gtf2h1 general transcription factor II H, polypeptide 1 NM_008186 128 1869-1996 TCACAGGTTTTGTGGGTTGA ACAGCATCAGCTCTGGGAGT Gtf2h1 general transcription factor II H, polypeptide 1 NM_008186 152 1910-2061 CTCTGGAAACCTGGCTGAAG TTCCCTCCCCAGAGTTAGGT Gtse1 G two S phase expressed protein 1 NM_013882 191 856-1046 AAAAGGGATCCCAGAGTGAC TGAAGCAGACCCTGAGGTAG Gtse1 G two S phase expressed protein 1 NM_013882 192 1314-1505 CCAGAGCAAAGAGGACCAAG CCGTGAGAACTTTGGGGTTA Gtse1 G two S phase expressed protein 1 NM_013882 219 655-873 GTCTGCCCTGTTCCTCTCAG CACTCTGGGATCCCTTTTCA Gzmb granzyme B NM_013542 186 TCCTGCTCTGATTACCCATC GGAAGATGTCAGTTGGGTTG Gzmb granzyme B NM_013542 258 ACTGCTGACCTTGTCTCTGG ACCATAGGGATGACTTGCTG Gzmb granzyme B NM_013542 230 215-446 TGGCCTTACTTTCGATCAAG CAGCATGATGTCATTGGAGA Gzmb granzyme B NM_013542 247 GCTGCAGGCATAGTTTCCTA AGAGCTGGTCCTTGTGAATG Gzme granzyme E NM_010373 214 321-534 GGAGACACAGCAGATCATCC GTCATTGATGGACCTTGACC Gzme granzyme E NM_010373 167 174-340 GGCGTTTGTTAAGTCTGTGG GGATGATCTGCTGTGTCTCC Gzme granzyme E NM_010373 186 242-427 ACTTTGTGCTGACTGCTGCT TGGCCTTACTCTCCAGCTTT Gzme granzyme E NM_010373 220 43-262 CTTCAACTGAGCAGCCTTCC GAGCAGCAGTCAGCACAAAG Gzme granzyme E NM_010373 246 74-319 CACCAGTCCTGATTCTCCTG CCTTAGCCTTGATGTTGTGG Gzme granzyme E NM_010373 151 436-586 AAAGCTGTGAGACCCCTCAA CATCCTCCTGGATGACCAGT Gzme granzyme E NM_010373 155 112-266 GGAGCTGGAGCAGAGGAGAT CAGTGAGCAGCAGTCAGCAC Gzme granzyme E NM_010373 239 312-550 GGCTAAGGAGGAGACACAGC GGGCAGATGCTTTAGTGTCA H2afz H2A histone family, member Z NM_016750 286 336-623 CGTATCACCCCTCGTCACTT AAGCCTCCAACTTGCTCAAA H2afz H2A histone family, member Z NM_016750 166 279-444 CTCACCGCAGAGGTACTTGA ATTTGTGGATGTGTGGGATG H2afz H2A histone family, member Z NM_016750 194 426-619 ATCCCACACATCCACAAATC GCCTCCAACTTGCTCAAATA Hc hemolytic complement NM_010406 175 1597-1771 TCCAGTGACACAGAACATGG TTGGCCTGGAGAATACACAT Hc hemolytic complement NM_010406 Hc hemolytic complement NM_010406 Hes1 hairy and enhancer of split 1 NM_008235 155 325-479 GCCTCTGAGCACAGAAAGTC TCCAGAATGTCTGCCTTCTC Hes1 hairy and enhancer of split 1 NM_008235 194 1118-1311 GCCCACCTCTCTCTTCTGAC TAATACAAAGGCGCAATCCA Hexim1 hexamethylene bis-acetamide inducible 1 NM_138753 214 TGCTGGGGAGTAGAAAGTGG CCAAGGTAGGCAAACAGGAA Hexim1 hexamethylene bis-acetamide inducible 1 NM_138753 255 GCCCTATAACACCACGCAGT TCCTGCTTGCTCATGTTCTG Hexim1 hexamethylene bis-acetamide inducible 1 NM_138753 117 GACGAATGCCTGTCCAGAAT GACTCTGACATCGGCTCTCC Hif1a hypoxia inducible factor 1, alpha subunit NM_010431 160 3470-3629 TCTGGAAGGTATGTGGCATT AGGGTGGGCAGAACATTTAT Hif1a hypoxia inducible factor 1, alpha subunit NM_010431 294 CCAGACAGAGCAGGAAAGAG CTCCGTTCCATTCTGTTCAC Hif1a hypoxia inducible factor 1, alpha subunit NM_010431 181 CTGGCTCCCTATATCCCAAT ATTCATCAGTGGTGGCAGTT Hmbs hydroxymethylbilane synthase NM_013168 178 518-695 ATTGGAAAGACCCTGGAAAC CCAGGATAATGGCACTGAAC Hmbs hydroxymethylbilane synthase NM_013168 175 246-420 TAGCGATGCTGAAAACCTTG AGGGAGTGAACAACCAGGTC Hmbs hydroxymethylbilane synthase NM_013168 202 763-964 CATGTATGCTGTGGGTCAGG CAGGTACAGTTGCCCATCCT Hmox1 heme oxygenase (decycling) 1 NM_010442 212 281-492 TGATGGCTTCCTTGTACCAT CTCGTGGAGACGCTTTACAT Hnf4g hepatocyte nuclear factor 4, gamma NM_013920 242 311-552 TTTATGTGCCATCTGTGGTG TACTGATTCTGTCGCGTTCA Hnf4g hepatocyte nuclear factor 4, gamma NM_013920 246 805-1050 ATGCTGGAGAACATCTGCTG CAGGGTCACTCAATCCCTTT Hnf4g hepatocyte nuclear factor 4, gamma NM_013920 239 106-334 GCTGCCTGAAAACTTCTTGG TCCTGTTGCTCTGTCACCAC Hp haptoglobin NM_017370 196 37-232 GAGAGGTCCACGATGAGAGC CTTCGGCCCGTAGTCTGTAG Hp haptoglobin NM_017370 220 762-981 GTATGTCATGCTGCCTGTGG GTACCAGGTGTCCTCCTCCA Hp haptoglobin NM_017370 224 58-281 CTGGGAGCTGTTGTCACTCT ACTGTGTTCACCCATTGCTT Hpse heparanase NM_152803 157 1000-1156 GCTCTGATGTGCTGGACACT ATAAAGCCAGCTGCAAAGGT Hpse heparanase NM_152803 183 1311-1493 CCCAGGGTGTTACTGTCAAG ATCCACTGGTTTCCTGAACA Hrk harakiri, BCL2 interacting protein NM_007545 199 5090-5288 AGGCTCTGGGAAGTCTGTCT ACAAAAGAGCACAAGGCAAC Hs3st5 heparan sulfate (glucosamine) 3-O-sulfotransferase 5 NM_001081208 200 1361-1560 AGCTTCCCAAGAGATCCACT GCTCCCTGACAATGATCAAC Hs3st5 heparan sulfate (glucosamine) 3-O-sulfotransferase 5 NM_001081208 238 646-883 GGGTACTGTGCTGCTTGTTT GTCAGCTGGCTGTTGAAGAT Hspa5 heat shock protein 5 NM_022310 194 1132-1325 CTCAGCATCAAGCAAGGATT AGATCCACCAACCAGAACAA Hspa5 heat shock protein 5 NM_022310 197 1707-1903 GGAGTTCCCCAGATTGAAGT CGCTCTTTGAGCTTTTTGTC Hspa5 heat shock protein 5 NM_022310 216 691-906 AGGAGACTGCTGAGGCGTAT CCAGGTCAAACACAAGGATG Hspa5 heat shock protein 5 NM_022310 208 2241-2448 GGAACTTTCGTTGGGAGAAA AAGGTGAACACACACCCTGA Htr2b 5-hydroxytryptamine (serotonin) receptor 2B NM_008311 162 1789-1950 GAGAGAGGTGATGAGCAGGA AGATTGCGTTTGTTTGAAGC Hus1 Hus1 homolog NM_008316 188 3307-3494 TGTCACTCCATCCACAGTTG ACCAGAGTCAAGAGCACCAG Hus1 Hus1 homolog NM_008316 214 2279-2492 ACCACTGGCTCTGCTGCTAT GCACAGTGGTGAAATTGGTG Hus1 Hus1 homolog NM_008316 110 2968-3077 TCCAAGTGGGCTTGTTATCC TTCTCTGTGGCAAGATGCAC Hus1 Hus1 homolog NM_008316 191 693-883 cagacacccagaagacatgg tgagacggtgctaggacaag Hus1 Hus1 homolog NM_008316 160 3811-3970 caaatgccagctcctgtcta tggagtgaagctgtgaaacc Icam1 intercellular adhesion molecule 1 NM_010493 222 1967-2188 CCTGCCTAAGGAAGACATGA CCCAGACTCTCACAGCATCT Icam1 intercellular adhesion molecule 1 NM_010493 158 772-929 ACCCAGCAGAAGTTGTTTTG TCGAACTCCTCAGTCACCTC Icam1 intercellular adhesion molecule 1 NM_010493 174 2275-2448 TATGTGGACTGGCAGTGGTT CCTTCCAGGCTTTCTCTTTG Icam1 intercellular adhesion molecule 1 NM_010493 218 1644-1861 TCAGGAGGAGGCCATAAAAC CCACCGAGTCCTCTTAGCTC Icos1 icos ligand NM_015790 181 GGCTCAGGACTAGGAAGACC GTAGCTGCCAACTCAAGACC Icos1 icos ligand NM_015790 197 1230-1427 AACGAGCTGTCTGCTTATGG TAGTAACGTGCCAAGGAAGG Ifi35 interferon-induced protein 35 NM_027320 243 931-1173 GCATGACATCCTTGAGATCC TCTGCCCTCTCTCTCAGCTA Ifi35 interferon-induced protein 35 NM_027320 177 1177-1353 CAGACCTTGACACTGGCTTT ATGCGCACCTTTAATCTCAG Ifi35 interferon-induced protein 35 NM_027320 201 427-627 TTCTGCTCTGGTCACCTTTG AGCCTAAGTCCAGCAGGAAA Ifi44 interferon-induced protein 44 NM_133871 240 2241-2480 CCCCGACCTCATTTATTTCT AGTCCATTCCCAGTCCTTTC Ifi44 interferon-induced protein 44 NM_133871 156 865-1020 CATATTCCATCAAGGCCAAG GTTTCATGGAATCGAACTGG Ifi44 interferon-induced protein 44 NM_133871 246 417-662 TTTGCACTCCAAGAGACTGG CACAGCAATGCCTCTTGTCT Ifit1 interferon-induced protein with tetratricopeptide repeats 1 NM_008331 237 587-823 CTGAAAGTGGAGCCAGAAAA ATAGCTTTGGCAAGATGTGC Ifit1 interferon-induced protein with tetratricopeptide repeats 1 NM_008331 241 1104-1344 AAGTGCAGGCAGAAATTCAC CTTTCAGCCACTTTCTCCAA Ifit1 interferon-induced protein with tetratricopeptide repeats 1 NM_008331 153 969-1121 AACTGAGGACATCCCGAAAC GAATTTCTGCCTGCACTTCA Ifit2 interferon-induced protein with tetratricopeptide repeats 2 NM_008332 175 1613-1787 TCAAATGAAGCGTCAAGACA CTCCTGAAGAAATGCCAAGA Ifit2 interferon-induced protein with tetratricopeptide repeats 2 NM_008332 162 810-971 AAGGCTCAGGCTTATCTGGA CAGAGCCTTCTGGAAACACA Ifit2 interferon-induced protein with tetratricopeptide repeats 2 NM_008332 167 247-413 ATTCTGCCGAAAAGCAAGTT CAACCTCTTCCTCTGCCTTC Ifna2 Interferon, alpha 2 NM_010503 201 284-484 CTTCATCTGCTGCTTGGAAT AGGGGCTGTGTTTCTTCTCT Ifna2 Interferon, alpha 2 NM_010503 208 320-527 cattctgcaatgacctccac gacagggctctccagacttc Ifna2 Interferon, alpha 2 NM_010503 215 11-225 tctgtgctttcctcgtgatg ttgagccttctggatctgct Ifna2 Interferon, alpha 2 NM_010503 233 71-303 gcgatctgcctcacacttat attccaagcagcagatgaag Ifnb1-3 interferon beta 1 NM_010510 283 149-431 GCAGCTGAATGGAAAGATCA GTGGAGAGCAGTTGAGGACA Ifnb1-4 interferon beta 1 NM_010510 148 99-246 CTCCAGCTCCAAGAAAGGAC TGGCAAAGGCAGTGTAACTC Ifnb1-5 interferon beta 1 NM_010510 109 117-225 ACGAACATTCGGAAATGTCA TCTGCATCTTCTCCGTCATC Ifng interferon gamma NM_008337 232 GTGATTGCGGGGTTGTATC CTGCTTTCTTTCAGGGACAG Ifng interferon gamma NM_008337 279 CAATGAACGCTACACACTGC CGCTTATGTTGTTGCTGATG Ifng interferon gamma NM_008337 181 301-481 AATCCTGCAGAGCCAGATTA TGGGTTGTTGACCTCAAACT Ifng interferon gamma NM_008337 185 CGGCTGACTGAACTCAGATT CTTTCAGGGACAGCCTGTTA Ifng-10 interferon gamma NM_008337 451 125-575 GCA TCT TGG CTT TGC AGC TC CGA CTC CTT TTC CGC TTC CT Ifng-11 interferon gamma NM_008337 227 98-326 GCTCTGAGACAATGAACGCT AAAGAGATAATCTGGCTCTGC Ifng-6 interferon gamma NM_008337 237 275-511 ACTGGCAAAAGGATGGTGAC TGAGCTCATTGAATGCTTGG Ifng-7 interferon gamma NM_008337 162 133-294 GCTTTGCAGCTCTTCCTCAT GTCACCATCCTTTTGCCAGT Ifng-8 interferon gamma NM_008337 188 293-480 ACATGAAAATCCTGCAGAGC TGGGTTGTTGACCTCAAACT Ifng-9 interferon gamma NM_008337 356 124-479 TGCATCTTGGCTTTGCAGCTCTTC GGGTTGTTGACCTCAAACTTGGCA Ifrg15 interferon alpha responsive gene NM_022329 244 683-926 ATTCACACTGCCCTGATTGT CAAGCTTTTTCAAAGGTCCA Ifrg15 interferon alpha responsive gene NM_022329 183 1249-1431 GCTCCCCCTTTCTAAGACTG GGGCCAGGTAGTTCTAAAGC Ifrg15 interferon alpha responsive gene NM_022329 225 114-338 GCAAACTCAACACAGCGACT AGTATTAGCGGGAGGCAGAA Ifrg15 interferon alpha responsive gene NM_022329 158 1978-2135 AACATTGGCCACGTTCTAGG TGCTTCTACACAGGCACTGG Igf1 insulin-like growth factor 1 NM_010512 156 2078-2233 ACTCACCACCCTGTGACCTC CCTGGAAACCCAGAACAAAA Igf1 insulin-like growth factor 1 NM_010512 167 5237-5403 TGTTGTTGTTGTTGGGTTTG TGCTAGCCAGCCTAGAAAGA Igf1 insulin-like growth factor 1 NM_010512 178 2707-2884 AAAAAGGCGCTGACATTCTT ACCTCAGGCTTGAGAAGGAA Igf1 insulin-like growth factor 1 NM_010512 168 3170-3337 ATGCAGAAGGTGCTGTTGAG GGTGTGTGAGGGCCTAACTT Igf1r insulin-like growth factor I receptor NM_010513 153 5571-5723 TTACCGTTTGGGAGAACTGG CTTGACCCACAACCTGACCT Igf1r insulin-like growth factor I receptor NM_010513 161 1961-2121 CAAGCTGTGTGTCTCCGAAA TGATTCGGTTCTTCCAGGTC Igf1r insulin-like growth factor I receptor NM_010513 214 7120-7333 GATGATGGTTGCAGTTGTGA ATCCATAACAGGGGCTTTTC Igf1r insulin-like growth factor I receptor NM_010513 173 8629-8801 ACTGTCCGAGTTGTTGGTGT GTCAGTCCAGCAGAACGACT Igf2 insulin-like growth factor 2 NM_010514 152 2647-2798 AGCAGTTTGCATGGTTTGAG ACCATGTGGACAGGTGCTTA Igf2 insulin-like growth factor 2 NM_010514 169 3167-3335 TCACAGGTCAACTTGCAGAA GCTCCCGTTATGTAGGGAAT Igf2 insulin-like growth factor 2 NM_010514 179 1599-1777 GATCGTGTTACCACCCAAAG AGGGAGTGGAGCAGAGAGAT Igf2 insulin-like growth factor 2 NM_010514 207 4382-4588 GTCCCCACATTTGCAGTTCT CTGGATGACATGGACAGTGG Igf2r insulin-like growth factor 2 receptor NM_010515 174 3370-3543 CTGCATTGGCTTGTACTCCT TATAAGGCAGAGGGTTGCAG Igf2r insulin-like growth factor 2 receptor NM_010515 217 1546-1762 AATACGCCTGCATCAAAGAG GCAGCATCTTCAGGACAGTT Igf2r insulin-like growth factor 2 receptor NM_010515 167 6838-7004 CCTCCAAGTGTGGGAAAGAT AAAGTCCACACCCAGAGGAC Igf2r insulin-like growth factor 2 receptor NM_010515 185 3849-4033 AGGCATGGCAATTTGTATGA ACTTTCTGGAATCCCTGTGG Igfbp1 insulin-like growth factor binding protein 1 NM_008341 250 584-833 GAGAGCCCAGAGATGACAGA TGTTGCAGTTTGGCAGATAA Igfbp1 insulin-like growth factor binding protein 1 NM_008341 209 815-1023 TATCTGCCAAACTGCAACAA TGTGTGAACACGGAAAAAGA Igfbp1 insulin-like growth factor binding protein 1 NM_008341 189 1270-1458 TTTGAAAGGGCAGAGTGATG AGCTTTCCACGTTCAGCTTT Igfbp1 insulin-like growth factor binding protein 1 NM_008341 199 587-785 AGCCCAGAGATGACAGAGGA GTTGGGCTGCAGCTAATCTC Igfbp3 insulin-like growth factor binding protein 3 NM_008343 194 1988-2181 GTTGATCTTGGGGTCCTTCT AGACACAGGCTCCTTTCCTT Igfbp3 insulin-like growth factor binding protein 3 NM_008343 243 842-1084 CACATCCCAAACTGTGACAA TGATCATGTTGTTGGCAGTC Igfbp4 insulin-like growth factor binding protein 4 NM_010517 153 1386-1538 TTGTGATTTCCTCCGATTGT TACACCTTCCTACGCTCTGG Igfbp4 insulin-like growth factor binding protein 4 NM_010517 179 1070-1248 ACCTGGCTTGGAGTCTGAGT TCAGACCTCTTGGGGGTATC Igfbp4 insulin-like growth factor binding protein 4 NM_010517 223 1439-1661 ACGGGAGAAGAGAAACCTCA ACCGAATACCCTGACCAAAG Igh immunoglobulin heavy chain complex BC004786 165 484-648 TCAGAGTCTGCGAGAAATCC TGGGAAGTTTACGGTGGTTA Igh immunoglobulin heavy chain complex BC004786 173 357-529 GCAAATGAGCCATCTGAAGT GTGGGAGTGTCAGTGGGTAG Igh immunoglobulin heavy chain complex BC004786 197 741-937 CGTGCAACATGACTCTAACG AGACAGCTCCCTCAGGATTT Igh immunoglobulin heavy chain complex BC004786 170 779-948 TGAAGTGCTCTGGTCCTCCT CTCCCAGGTGAAGACAGCTC Igh immunoglobulin heavy chain complex BC004786 156 158-313 GAGGGTCCCTGAAACTCTCC GGCCCTTTACATTGTCTGGA Igh immunoglobulin heavy chain complex BC004786 178 1066-1243 AAGTGCACAGTTACCCATCC CCAGCACTTCTTTAGGGTTG Igh-6 IgM/kappa antibody, scFvGUS-CK Z95476 159 583-741 GCAGCTTTCATGTCCAGACT GGTTCCTTGACCCCAGTAGT Igh-6 IgM/kappa antibody, scFvGUS-CK Z95476 238 56-293 TGTCTGCAGGAGAAAAGGTC TAAACTGCCAGGTCTTCAGC Igh-6 IgM/kappa antibody, scFvGUS-CK Z95476 223 334-556 GGGACCAAGCTGGAAATAAA ATATCACTCCCAGCCACTCC Igh-6 IgM/kappa antibody, scFvGUS-CK Z95476 227 542-768 GGCTGGGAGTGATATGGAGA TGTTTTGGGTGCAGAGACTG Igh-6 IgM/kappa antibody, scFvGUS-CK Z95476 178 149-326 AGAAACCAGGGCAGTCTCCT AACGTGAGCGAGGAGAGGTA Igh-6 IgM/kappa antibody, scFvGUS-CK Z95476 153 522-674 TCCAGGAAAGGGTCTGGAGT GCAGTGTCATCAGCTTGCAG Igh-6 IgM/kappa antibody, scFvGUS-CK Z95476 200 273-472 AGCTGAAGACCTGGCAGTTT CTGTGCAGGTTATGGACAGG Igh-6 IgM/kappa antibody, scFvGUS-CK Z95476 208 350-557 TAAAACGGGAGGGTAAATCC CATATCACTCCCAGCCACTC Igh-6 IgM/kappa antibody, scFvGUS-CK Z95476 227 451-677 AGCCTGTCCATAACCTGCAC ATGGCAGTGTCATCAGCTTG Igj immunoglobulin joining chain NM_152839 208 167-374 GCATGTGTACCCGAGTTACC TGATCTTCCAGCTCCACTTC Igj immunoglobulin joining chain NM_152839 232 200-431 CTTCCACCGAGGATCCTAAT GTCTCAGGAACACCATCGTC Igj immunoglobulin joining chain NM_152839 204 92-295 GAGTCCTGGCCATTTTTGTT GGGAGGTGGGATCAGAGATA Ikbkb inhibitor of kappaB kinase beta NM_010546 157 3390-3546 ATCTCCAGGTGGACATCTCA TCTTTGTACAGCAGCCATGA Ikbke inhibitor of kappaB kinase epsilon NM_019777 193 369-561 TGTGGCATACTGATGACCTG GCGAATAGCTTCACGATGTT Ikbkg inhibitor of kappaB kinase gamma NM_010547 156 384-539 GGAGTTGGAGCAACTGAAGA CGAATCCTTCCCTCTAAAGC Ikbkg inhibitor of kappaB kinase gamma NM_010547 153 1175-1327 ACTTCTGTTGTCCGAAGTGC GCAGGTAAAACAGGAAAGCA Ikbkg inhibitor of kappaB kinase gamma NM_010547 164 1373-1536 TAGGGTAGACAGCCCCATTC AAGCTGTACCCAGACCTGCT Il10 interleukin 10 NM_010548 274 TTGCTCTCATCCCTGAGTTC ATGCTGCTACAAAGGCAGAC Il10 interleukin 10 NM_010548 250 AGTGGAGCAGGTGAAGAGTG TTCGGAGAGAGGTACAAACG Il10 interleukin 10 NM_010548 191 318-508 AGCCTTATCGGAAATGATCC CACTCTTCACCTGCTCCACT Il10 interleukin 10 NM_010548 191 218-408 TCAGCCAGGTGAAGACTTTC GGAATTCAAATGCTCCTTGA Il10ra Interleukin 10 receptor, alpha NM_008348 182 420-601 ACCACTGAGACTCGCTTCAC TTCCGGATGGAAATCTTGTA Il10rb Interleukin 10 receptor, beta NM_008349 225 1187-1411 GCACTGGTACACACAACCAA CTGTGATCCTCCTGCCTCTA Il12b interleukin 12b NM_008352 285 CATCTACCGAAGTCCAATGC TGCGGGCATTTAACATTTAC Il12b interleukin 12b NM_008352 207 ACAGCACCAGCTTCTTCATC GGTTACACCCCTCCTCTGTC Il12b interleukin 12b NM_008352 167 TGTCTGCAGAGAAGGTCACA GATGAAGAAGCTGGTGCTGT Il12b interleukin 12b NM_008352 211 1559-1770 CAATCAGGGCTTCGTAGGTA GGCCCTGGTTTCTTATCAAT Il12b interleukin 12b NM_008352 241 1035-1275 aggtgcgttcctcgtagaga aaagccaaccaagcagaaga Il12b interleukin 12b NM_008352 243 89-331 cctgcatctagaggctgtcc catcttcttcaggcgtgtca Il12b interleukin 12b NM_008352 173 689-861 aggtcacactggaccaaagg tggtttgatgatgtccctga Il13 interleukin 13 NM_008355 189 ACAGTTCTACAGCTCCCTGGT GGAGTCTGGTCTTGTGTGATG Il13 interleukin 13 NM_008355 164 AAGGAGCTTATTGAGGAGCTG ATCCTCTGGGTCCTGTAGATG Il13 interleukin 13 NM_008355 155 TCCCATCCCTACAGAAAACTG CCGGGATACTGACAGACTCAT Il13 interleukin 13 NM_008355 281 CTCTGCTACCTCACTGTAGCC TTCCGGTTTCTAGTTTGACAG Il13 interleukin 13 NM_008355 171 TACAGCTCCCTGGTTCTCTCA TTGTGTGATGTTGCTCAGCTC Il13 interleukin 13 NM_008355 167 GCTGAGCAACATCACACAAGA GGTTACAGAGGCCATGCAATA Il13 interleukin 13 NM_008355 152 CCAATTGCAATGCCATCTAC GCGAAACAGTTGCTTTGTGT Il13 interleukin 13 NM_008355 222 GGTTCTGTGTAGCCCTGGAT CAGGGATGGTCTCTCCTCAT Il13 interleukin 13 NM_008355 162 32-193 CTACAGCTCCCTGGTTCTCT TTGCTCAGCTCCTCAATAAG Il13a1 Interleukin 13 receptor, alpha 1 NM_133990 155 1903-2057 CCAAGGCAATGACACATACA AAATGAAAGGTGGGCATACA Il17a interleukin 17A NM_010552 231 248-478 GAAGGCCCTCAGACTACCTC TCTTCTCGACCCTGAAAGTG Il17a interleukin 17A NM_010552 177 250-426 AGGCCCTCAGACTACCTCAA CAGGATCTCTTGCTGGATGA Il17a interleukin 17A NM_010552 195 85-279 TCTCTGATGCTGTTGCTGCT CGTGGAACGGTTGAGGTAGT Il17a interleukin 17A NM_010552 157 245-401 ccagaaggccctcagactac gaattcatgtggtggtccag Il17a interleukin 17A NM_010552 218 430-647 ctgaagagggagcctgagag gcctctgaatccacattcct Il17a interleukin 17A NM_010552 162 321-482 tccctctgtgatctgggaag agcatcttctcgaccctgaa Il18bp interleukin 18 binding protein NM_010531 207 257-463 GCCACTGTCTTAACTGGAAGC GTGCTCAATGAAGGAACCATT Il18bp interleukin 18 binding protein NM_010531 262 AATGGTTCCTTCATTGAGCAC ATACTGGGCTGTGGCTAGAGA Il18bp interleukin 18 binding protein NM_010531 206 889-1094 CTTCCTGTTTGTCCTCCTGTC TCT CAA CTA GGC TTC GGG TTA Il1f10 Interleukin 1 family, member 10 (theta) NM_153077 222 231-452 TGGCGTGTGTAAAGACAAGA TGGAGGGTTCACTCTCTTTG Il1f10 Interleukin 1 family, member 10 (theta) NM_153077 172 4-175 agaccagacactcccaactg gcctcggttaggaaggatac Il1f10 Interleukin 1 family, member 10 (theta) NM_153077 206 83-291 gctttgtacacacggaatgg tcctcgatgttcacatcctc Il1f9 Interleukin 1 family, member 9 NM_153511 231 58-288 TGATGTTGAGATGGAACACG GACTCTGGGTACTTGCATGG Il1f9 Interleukin 1 family, member 9 NM_153511 174 4-177 ccagaacaagatcacgatgg tcaaaaacctccccaaagtc Il1f9 Interleukin 1 family, member 9 NM_153511 186 73-258 acacgagagagctgggctat acgctgactggggttactct Il1r1 Interleukin 1 receptor, type I NM_008362 233 1476-1708 TTGGAGGGACAGTTTGGATA TTCTCCAACTCAAGCAGGAC Il1r1 Interleukin 1 receptor, type I NM_008362 245 786-1030 aatgtggctgaagagcacag tctgatccattccacttcca Il1r1 Interleukin 1 receptor, type I NM_008362 179 2778-2956 cgcagaagctgaagtctacg caggtggcagaaatgctaga Il1r1 Interleukin 1 receptor, type I NM_008362 218 4135-4352 agaaacttggccagagagga gatacttctggggaggacca Il1rapl2 interleukin 1 receptor accessory protein-like 2 NM_030688 219 1582-1800 GAACTGGAAAGCAGACTCCA TTTCTTGATGGGCATTTCAT Il1rapl2 interleukin 1 receptor accessory protein-like 2 NM_030688 156 1140-1295 ACACGCCAGTGTTCTACTGC CCTCCAAAACGCTGTCTGTA Il1rapl2 interleukin 1 receptor accessory protein-like 2 NM_030688 238 1669-1906 AATTGCCAGGAAGTGGAATC TTGTGGCTGAGGTACTCGTC Il2 interleukin 2 NM_008366 200 TTGACACTTGTGCTCCTTGTC AATTTGAAGGTGAGCATCCTG Il2 interleukin 2 NM_008366 280 GCAGGATGGAGAATTACAGGA AGAAAGTCCACCACAGTTGCT Il2 interleukin 2 NM_008366 215 6-220 CCTTGCTAATCACTCCTCACA CCTTGCTAATCACTCCTCACA IL21 interleukin 21 NM_021782 162 CACTAGCCATGGGAAAGCTA CAACCTTCATGGACACACAA IL21 interleukin 21 NM_021782 150 CAGATCGCCTCCTGATTAGA CCTTCTGAAAACAGGCAAAA IL21 interleukin 21 NM_021782 171 CCCTTCCTGTGATTCGTATG TCTATAGTGTCCGGCGTCTC IL21 interleukin 21 NM_021782 179 AGGAGGGGAGGAAAGAAACA GGGAATCTTCTCGGATCCTC IL21 interleukin 21 NM_021782 184 1374-1557 CTGCTAGCTCCAGCCTCAGT ACCTCTGGTCTCTTGGCTCA IL21 interleukin 21 NM_021782 216 1838-2053 CCGTGTACCGCCCTAAGATA AGCTTTCGAGCAGCAAACTC Il23r interleukin 23 receptor NM_144548 199 995-1193 TTCAAGTGCGATGTCAAGAA GCACTGAGCATCTCCATCTT Il23r interleukin 23 receptor NM_144548 248 1959-2206 GGCAATTGGGAATGAAGACT CAAGCACAGCCTCATTGTTT Il23r interleukin 23 receptor NM_144548 221 9-229 GGGAAAGAAGACAGCACAGC CAACCCACATGTCACCAGAG Il23r interleukin 23 receptor NM_144548 229 211-439 TCTGGTGACATGTGGGTTGA CAGGACATTCAGCAGTGCAA Il23r interleukin 23 receptor NM_144548 175 2164-2338 ACTGGCAAAACAAAGCAAAA AGAGGCAGGAAAACCAAGAG Il23r interleukin 23 receptor NM_144548 218 700-917 GTATGGGTCCAAGCTGTCAA CTCCACGTTTGGTTTGTTGT Il2ra interleukin 2 receptor, alpha chain NM_008367 279 454-732 CACAACAGACATGCAGAAGC TCCTCACTAGCCAGAAATCG Il2ra interleukin 2 receptor, alpha chain NM_008367 176 298-473 TGAATGCAAGAGAGGTTTCC GCTTCTGCATGTCTGTTGTG Il2ra interleukin 2 receptor, alpha chain NM_008367 110 703-812 AGAACACCACCGATTTCTGG CTGTGGGTTGTGGGAAGTCT Il2ra interleukin 2 receptor, alpha chain NM_008367 189 3746-3934 TGGCCACTGTGTAGTGTACC CATGCTTGATAATTCCCACA Il2ra interleukin 2 receptor, alpha chain NM_008367 222 2926-3147 TACCCCTCAACCTTTCCATA GGCTGTAGAGATGGCTCAGT Il2ra interleukin 2 receptor, alpha chain NM_008367 152 1876-2027 AGCTGTCAATTGTACGCTCA CTTCCTTTTTCCTTCCTTCC IL2Rg interleukin 2 receptor, gamma chain NM_013563 163 1114-1276 TCCCCCATGTTATTCTCTGA GGGACAGGAAATCGAAACTT IL2Rg interleukin 2 receptor, gamma chain NM_013563 247 716-962 CGCTATAACCCAATCTGTGG CCGAAAAGTTCCCTTGGTAT IL2Rg interleukin 2 receptor, gamma chain NM_013563 185 12-196 CACCCAGAGAAAGAAGAGCA AGGAGCACTGAGGTGTTCAG Il4 interleukin 4 NM_021283 209 CATCCTGCTCTTCTTTCTCG AAAATATGCGAAGCACCTTG Il4 interleukin 4 NM_021283 272 GAGAGATCATCGGCATTTTG GGACTTGGACTCATTCATGG Il4 interleukin 4 NM_021283 199 70-308 CAAGGTGCTTCGCATATTTT ATCCATTTGCATGATGCTCT Il4 interleukin 4 NM_021283 239 GACGGCACAGAGCTATTGAT ACCTTGGAAGCCCTACAGAC Il5 interleukin 5 NM_010558 176 657-832 CTGGCCTCAAACTGGTAATG TGAGGGGGAGGGAGTATAAC Il5 interleukin 5 NM_010558 225 GAGGCTTCCTGTCCCTACTC ACACCAAGGAACTCTTGCAG Il5ra Interleukin 5 receptor, alpha NM_008370 201 1894-2094 TCACTCAAACCTCCTTGCTC GAGTGCTACCACTGGCAACT Il6-1 interleukin 6 NM_031168 165 440-604 GACAAAGCCAGAGTCCTTCA TTGGATGGTCTTGGTCCTTA Il6-2 interleukin 6 NM_031168 218 122-339 CGGAGAGGAGACTTCACAGA CCAGTTTGGTAGCATCCATC Il6-3 interleukin 6 NM_031168 180 46-225 TGCAAGAGACTTCCATCCAG ATTTCCACGATTTCCCAGAG Il6-4 interleukin 6 NM_031168 187 528-714 CTACCCCAATTTCCAATGCT ACCACAGTGAGGAATGTCCA Il6-5 interleukin 6 NM_031168 159 64-222 AGTTGCCTTCTTGGGACTGA TCCACGATTTCCCAGAGAAC Il6-6 interleukin 6 NM_031168 121-286 166 CCGGAGAGGAGACTTCACAG TTCTGCAAGTGCATCATCGT Il8ra Interleukin 8 receptor, alpha NM_178241 194 538-731 GGCATCTGGGGTCTATCTTT CCGTAGCAGACCAGCATAGT Il8rb interleukin 8 receptor, beta NM_009909 219 2450-2668 ACTAGGCAGATGCCAACAAG GGGGGTACTGGCTAGTTCAT Il8rb interleukin 8 receptor, beta NM_009909 197 1362-1558 agagcccccagagtttagaa tctctcctccacctcttcct Il8rb interleukin 8 receptor, beta NM_009909 219 1063-1281 ctgccttaaccccatcatct gccatgctgaaagacaagaa Il8rb interleukin 8 receptor, beta NM_009909 232 1193-1424 tcgtcttcagcaaacacctc aggcataccaagatggaagg Il9r Interleukin 9 receptor NM_008374 217 400-616 CCTGGTGGACTCACAGTACC CCAGGTCACTCCAACGATAC Il9r Interleukin 9 receptor NM_008374 167 1803-1969 ggtctgttcttccaccccta tgctcaaagctccatcattc Il9r Interleukin 9 receptor NM_008374 245 2467-2711 agaatgacgatgcccctaac ggacactcagaggggaatgt Il9r Interleukin 9 receptor NM_008374 227 2306-2532 acagctcggccaaatagaga acattctagcccacccacag Indo indoleamine-pyrrole 2,3 dioxygenase NM_008324 196 474-669 TGGCAAACTGGAAGAAAAAG AATGCTTTCAGGTCTTGACG Indo indoleamine-pyrrole 2,3 dioxygenase NM_008324 204 216-419 ATCTGCCTGTGCTGATTGAG CGCAGTAGGGAACAGCAATA Indo indoleamine-pyrrole 2,3 dioxygenase NM_008324 225 48-272 GGGGGTCAGTGGAGTAGACA TGGGCAGCTTTTCAACTTCT Ins1 insulin I NM_008386 222 757-978 GGTAGGCAACCGTGTAAATG TTGTGGGGATAATAGGAGCA Irak1 interleukin-1 receptor-associated kinase 1 NM_008363 165 3121-3285 GGCAGGCTCTCTCTATACCC TGTAACATTCTTCCCCCTCA Irak1 interleukin-1 receptor-associated kinase 1 NM_008363 163 1381-1543 CTGTGGACACCGATACCTTC AGAGTAGGCTGGGTGCTTTT Irak1 interleukin-1 receptor-associated kinase 1 NM_008363 299 2224-2522 TGCTGTCATCAGGCTTTTTC ATTGCCTGCCTTATCAGCTT Irak2 interleukin-1 receptor-associated kinase 2 NM_172161 171 169-339 CAGTTCGCTTCCTACGTGAT AGCTCGGTAGAGTTCCAGGT Irf4 interferon regulatory factor 4 NM_013674 200 1917-2116 TCCTGATCCTGCACTCTCTC AGGGGAGACAACAACAACAA Irf4 interferon regulatory factor 4 NM_013674 174 3716-3889 TGGTAGACCCCACCTGTAGA GGGCACCTCACATATCAGTC Irf4 interferon regulatory factor 4 NM_013674 220 524-743 TACCCCATGACAGCACCTTA GGGCACAAGCATAAAAGGTT Irf4 interferon regulatory factor 4 NM_013674 159 3495-3653 TCCCTTGCTGAAACAAAGTG CTGCTCAAGGACCAGAAACA Irf4-5 interferon regulatory factor 4 NM_013674 200 1917-2116 TCCTGATCCTGCACTCTCTC AGGGGAGACAACAACAACAA Irf4-6 interferon regulatory factor 4 NM_013674 220 524-743 TACCCCATGACAGCACCTTA GGGCACAAGCATAAAAGGTT Irf4-7 interferon regulatory factor 4 NM_013674 168 3607-3774 AAGTCTCACGGGTGCTTTCT AAGCCTCTCTGTGCTCCAAT Irf8 interferon regulatory factor 8 NM_008320 223 1761-1983 GGCTCAGCTGTCAATCACTT TATGGAGCTGGACAAGGAAG Irf8 interferon regulatory factor 8 NM_008320 234 2310-2543 AGGAGAGCTTCTCCGTTTGT AGCACCTTCACACAGTAGCC Irf8 interferon regulatory factor 8 NM_008320 236 422-657 CATGAGCGAAGTTCCTGAGA TGATGACCATCTGGGAGAAA Irf8 interferon regulatory factor 8 NM_008320 176 1371-1546 AATTCCGAAAGGATGTGGAG TTAGTGGTGAAGGGGGAAAC Irs1 insulin receptor substrate 1 NM_010570 196 3733-3928 GACTGGCTCGGAAGAGTACA GCTTTGACGAGGACAACCTA Irs2 insulin receptor substrate 2 NM_001081212 200 1531-1730 AGTAGCCACAGGAGCAACAC GGCGTGGTTAGGGAATAAGT Itch itchy, E3 ubiquitin protein ligase NM_008395 180 221-400 ACAGCTTGATTCCATGGGTA TTCCACTTGGGACTGTTTGT Itch itchy, E3 ubiquitin protein ligase NM_008395 240 2027-2266 GGCTCTGTTTCATGGGAAAT ATATTGCCACCATTGGGTTT Itga1 integrin alpha 1 NM_001033228 245 1914-2158 CCACAATTGACATCGACAAA AGCAACTGCTGTTCCAAAAC Itga1 integrin alpha 1 NM_001033228 207 5770-5976 AGCTCCATGCCTTTAGGAGT TCTTTTTATCTGGCCAAACG Itga1 integrin alpha 1 NM_001033228 243 3321-3563 CTGCCAATGAGACTGTTCCT TCCCAGAGTTGATACCCAAA Itga1 integrin alpha 1 NM_001033228 204 797-1000 AATCCGAAGGGAGGATTTCT GACACTTTCCCAGGGGTAGA Itga2 integrin alpha 2 NM_008396 199 2310-2508 TTCTGAGCACCACATTAGCA GACATCCAGGATCAGGTCAG Itga3 integrin alpha 3 NM_013565 172 2055-2226 GGACAATGTTCGCGATAAAC GCACTCTTTCTGGAAGTGGA Itga3 integrin alpha 3 NM_013565 150 690-839 acggatggacatttcagaga tcttctagcccagaccacag Itga3 integrin alpha 3 NM_013565 225 2932-3156 ggaaaccttgtcaaccctct aatgttggaggtgtctggaa Itga3 integrin alpha 3 NM_013565 244 3710-3953 cgggaccgatactactgatg agtaggccctgtgtgtgtgt Itga4 integrin alpha 4 NM_010576 188 2970-3157 AAGCCAGCGTTCATATTCAG TCGTTTGGGTCTTTGATGAT Itga5 integrin alpha 5 NM_010577 207 1677-1885 GATCCTTTGGTGTGGACAAG AGTTCCACCTCGAAGCCTAT Itga5 integrin alpha 5 NM_010577 202 GTCAGACACCCAGGGAACTT CCTCAGCAAGAACCTGAACA Itga7 integrin alpha 7 NM_008398 202 2434-2635 CTATGAAGAGAGGCGCTCAG AAGAAGAGTTGCTGGGGAGT Itga7 integrin alpha 7 NM_008398 177 2952-3128 GAGAAGGTGGAGCCTAGCAC CAGAAAGGTGCTGTTCCAGA Itga7 integrin alpha 7 NM_008398 193 664-856 GCTTTGTGCTAAGCCAGGAC AAAAGCAACCCCTTCCAGTT Itgav integrin alpha V NM_008402 166 3400-3565 GACCACCTCAAGAAGAGCAA CCTGGGATTTCACTGTTCAC Itgb1 integrin beta 1 NM_010578 150 1825-1974 CTGGAAAATTCTGCGAGTGT ATGGACCAGTGTCCAAAGAA Itgb3 integrin beta 3 NM_016780 224 2075-2298 TGACATCGAGCAGGTGAAAG GAGTAGCAAGGCCAATGAGC Itgb3 integrin beta 3 NM_016780 153 735-887 AAACACGTGCTGACGCTAAC GTCATTCCTCCAGCCAATTT Itgb3 integrin beta 3 NM_016780 250 3581-3830 GGTCAGATGCTTTCTCCTCA TCTGACTGGCCTTTCAACTC Itgb6 integrin beta 6 NM_021359 210 tcagcttggtctcaaacctc agtgaatctgctggttgctc Itgb7 integrin beta 7 NM_013566 173 1270-1442 TCTTGAGCACTCTCCACTCC CTTCTGGGAGGCAGTGAGTA Itgb7 integrin beta 7 NM_013566 160 1373-1532 AATGATGTCCGAGTCAACCA GGGCATCACCACAGTTACAG Itgb7 integrin beta 7 NM_013566 244 2375-2618 GAGCAGCAGCAACTCAACTG CTGCCCTCTGAAGGTCACTC Itgb8 BC120691 265 507-772 ACTGCTGCACTGCTCTCTCT AATCAACTGGACAGCCTTTG Itgb8 BC120691 244 1499-1743 TTTTGCAGTTCAAGGAAAGC GTTTCCACACCCACTTATGC Itgb8 BC120691 208 1535-1742 GACCTTCTGCCCCTTTTG CGTTTCCACACCCACTTATG Itgb8 BC120691 215 1024-1238 TGACTTCCGTCTTGGTTTTG CAGGGGTGTCTATGTTTCCA Itgb8 BC120691 285 1012-1296 CCTTTATTCCCGTGACTTCC CGCCATCCAATATGACTCTC Jak1 Janus kinase 1 NM_146145 294 GAGCCTGGCATACACACTCT CCTCCAAGTCAACCAACAAC Jak1 Janus kinase 1 NM_146145 177 ATGGTGGAAGAGTTTGTGGA GGCCAGAAGGAGGTTTTTAG Jak1 Janus kinase 1 NM_146145 213 1689-1901 GTGAAGAGGGGATGTACGTG TCTGCTTCTTGAGGTGGTTC Jam3 junction adhesion molecule 3 NM_023277 231 1269-1499 ACAACACTGGCAGAGAGAGG CAGCAAGCAATTTCACCTTT Jam3 junction adhesion molecule 3 NM_023277 201 619-819 GCACTCTGGTTTTCAATGCT GTCTGTACGCACAGCAGATG Jam3 junction adhesion molecule 3 NM_023277 171 708-878 GGGCAGGACATGGAAGTCTA ATGCTTCCCTGGGCTCTTAT Jarid1c jumonji, AT rich interactive domain 1C NM_013668 299 GCACAGACCCCAACAAAGAT CCCTGGATTTGTCTCTGGAA Jarid1c jumonji, AT rich interactive domain 1C NM_013668 117 ACCTCTGCAAGTGCTCCAGT TAGCCCAGGTGTCAAAGGAC Jarid1c jumonji, AT rich interactive domain 1C NM_013668 239 AGTGACAGTAAGCGGCACCT TACCAGGTTTTTGGCTCACC Jarid1c jumonji, AT rich interactive domain 1C NM_013668 235 1161-1395 TCCTAGAAGGCAAGGAGGAA GGACACCTCCAGACACCTTT Jarid1c jumonji, AT rich interactive domain 1C NM_013668 293 1679-1971 CCAGAGGAGGAGGAGTATGC GGCTGGCTATCAAAAAGCTC Jarid1c jumonji, AT rich interactive domain 1C NM_013668 283 AGAGGGTACGAAGCTCAGGA AGGATCTTTGTTGGGGTCTG Jun Jun oncogene NM_010591 169 967-1135 GAAACGACCTTCTACGACGA TGAGAAGGTCCGAGTTCTTG Jun Jun oncogene NM_010591 220 1813-2032 AAAACCTTGAAAGCGCAAAA CGCAACCAGTCAAGTTCTCA Jun Jun oncogene NM_010591 157 2547-2701 TGTCCTGCCCAGTGTTTGTA GAGGTTGGGGGCTACTTTTC Junb Jun-B oncogene NM_008416 240 871-1110 TTACTCTCCAGCCTCTGCAC TCCTGGTCTTCCATGTTGAT Junb Jun-B oncogene NM_008416 223 117-339 ACGGAGGGAGAGAAAAGCTC TGTTCCATTTTCGTGCACAT Junb Jun-B oncogene NM_008416 244 516-769 GCAGCTACTTTTCGGGTCAG TTCATCTTGTGCAGGTCGTC Jund Jun proto-oncogene related gene d NM_010592 176 366-541 TATGAAACAGGGGGACTGAA GAAACTGAGGATGGGATGTG Jund Jun proto-oncogene related gene d NM_010592 238 2593-2830 GCCTTTTGGAAGAGAGAACG TTACGGAACAGGAATGTGGA Jund Jun proto-oncogene related gene d NM_010592 229 583-811 TCCACCCTGTGAAACTGACA TGTCTCTGGCACTTCTGTGG Kcnn1 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1 NM_032397 155 1125-1279 TCCATCACCTTCTTGTCCAT TTCTCAGCCTTGGTGAGTTC Kcnn1 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1 NM_032397 189 3734-3922 GGATCAGGGCCTCATAATTT GGAGTGTTCCACTGTCAACC Kcnn1 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1 NM_032397 183 454-636 AAAAGCGTAAACGGCTCAGT CGTGGTACAGGATGACAAGG Kcnn1 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1 NM_032397 232 1866-2097 GAAGCTTGGGTGAACTGAGC CCATTAAGGAATCCCCAGGT Kcnn1 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1 NM_032397 161 2076-2236 CCACCTGGGGATTCCTTAAT AGTGGCCTCACCTCTCTGAA Kcnn1 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1 NM_032397 227 2354-2580 CAGGGTTACAGACGAGCAGA GCTCCACCCCACAAACTTAT Kiss1 KiSS-1 metastasis-suppressor NM_178260 221 142-362 GACCCCAGGAACTCGTTAAT CCAGTTGTAGGTGGACAGGT Kntc1 kinetochore associated 1 NM_001042421 238 935-1172 GACAACCTGCTTTTTGTGCT CCATCGAAGGCAGAGAGTAA Kntc1 kinetochore associated 1 NM_001042421 127 1820-1946 GAAGGAAACTTCGCTTGTGC GGTTTTCCAAGGGGAATTGT Kntc1 kinetochore associated 1 NM_001042421 184 5008-5191 AATCGCGAAGCTGATGAAGT GTTGACGATGGACAGGAGGT Kntc1 kinetochore associated 1 NM_001042421 175 1997-2171 cccgaaggacaaaacattct aatccaaggaaatccagtgc Kntc1 kinetochore associated 1 NM_001042421 239 4243-4481 taaagcgtggcagaattacg ggctggtgtccatgtctatg Kpna2 karyopherin (importin) alpha 2 NM_010655 249 1755-2003 GAGCTCCTGGGACCTTTAAC AGGACATGACAGGGTACGAA Krt5 keratin 5 NM_027011 195 559-753 ACTGAGGAGAGGGAGCAGAT CAGCTGTCTACGGAGGTTGT Krt5 keratin 5 NM_027011 233 1340-1572 AAGATGCCAGAAACAAGCTG TCCGTAGCCAGAAGAGACAC Krt5 keratin 5 NM_027011 179 1726-1904 AGTCAAGGAGGCATGAGCTT CCTGGGAGACTGCCTAAAAG Krt5 keratin 5 NM_027011 217 1271-1487 TCAAGAAGCAGTGTGCCAAC TCCAGCAGCTTCCTGTAGGT Krt5 keratin 5 NM_027011 200 1906-2105 CACGTTTCCTTTTTCTGGAG GTTCTGCTTTGGTGGCTTAC Krt5 keratin 5 NM_027011 224 1022-1245 ACACATCTGTGGTCCTTTCC CTGGATCATTCGGTTCATCT Krt5 keratin 5 NM_027011 162 1326-1487 GGAGCTGGCTCTCAAAGATG TCCAGCAGCTTCCTGTAGGT Krt5 keratin 5 NM_027011 191 1556-1746 TCTCTTCTGGCTACGGAGGA GAAGCTCATGCCTCCTTGAC Krt5 keratin 5 NM_027011 226 1905-2130 CCACGTTTCCTTTTTCTGGA AGGTGGGTATCTGGGTAGGG LAMB3 laminin, beta 3 NM_008484 165 GCAGATGAAATGCTGCAAGT TGAAGCTGCATCCTCTTGTC LAMB3 laminin, beta 3 NM_008484 GGGGCCTGTTATCCACCTGT AGAGAGACAGGGCTCACATC LAMB3 laminin, beta 3 NM_008484 184 2990-3173 GGCTCCCTAATGTGGACTCA TGCATTGTGTCCTGAGCTTC LAMB3 laminin, beta 3 NM_008484 182 813-994 TGGGGACATCACAAACTTGA CCTGCACAGCAGTGGTAGAA Lamp1 lysosomal-associated membrane protein 1 NM_010684 147 930-1076 TCTATGGCACTGCAACTGAA GGCTCTGTTCTTGTTCTCCA Lamp2 lysosomal-associated membrane protein 2 NM_001017959 132 785-916 AACTTCAACACCCACTCCAA AAAGGCACCTTCTCCTCAGT Lamp3 lysosomal-associated membrane protein 3 NM_177356 156 702-857 TCACCTGTTCCCCTAGTTCC GGTTGCAGAATCCAAATCCT Large like-glycosyltransferase NM_010687 159 238-396 CAGCCATCACCTGGATTTAC CCTCCTCAACTTCTCGAACA Large like-glycosyltransferase NM_010687 250 911-1160 CTTTGCAACAGACATTGCAG AGACAACATGCCCATGAGTT Large like-glycosyltransferase NM_010687 164 707-870 TGAGCAGATCCTGGCTACAC CAGGCAGAGTTTTGGTCAGA Lcat lecithin cholesterol acyltransferase NM_008490 223 211-433 GGTGAACTGGATGTGCTACC GCCTGCTAGCTTGTTGTCAT Lcn2 lipocalin 2 NM_005564 233 323-555 tacaatgtcacctccgtcct gttctcccgtagagggtgat Lcn2 lipocalin 2 NM_005564 209 69-277 aaatcatgcccctaggtctc cgggtctttgtcttctctga Lcn2 lipocalin 2 NM_005564 193 481-673 ccagcatgctatggtgttct cactcagccgtcgatacact Lcn2 lipocalin 2 NM_005564 132 464-595 gtgagcaccaactacaacca gcggatgaagttctccttta Lcn2 lipocalin 2 NM_005564 88 556-643 caaggagctgacttcggaac gacagggaagacgatgtggt Lcn2 lipocalin 2 NM_005564 198 624-821 accacatcgtcttccctgtc gcctgagggcacatgtttat Lcn2 lipocalin 2 NM_005564 118 332-449 ACATTTGTTCCAAGCTCCAGGGC CATGGCGAACTGGTTGTAGTCCG Ldlr low density lipoprotein receptor NM_010700 164 437-600 GACTCCTGGAGATGTGATGG TCAGAGCCATCTAGGCAATC Ldlr low density lipoprotein receptor NM_010700 184 3276-3459 TCAGAAGCCAGGAAAGTGAC AAGGCAACCAGTTGTCTCAG Ldlr low density lipoprotein receptor NM_010700 212 2143-2354 CCTGTTCCACAAGGTCACAC CCTGGGTGGTCAGTACAGTG Ldlr low density lipoprotein receptor NM_010700 210 2984-3193 GAAAAGGCTACTGGCTGTGC CCAGGACCCGGTCAGTAGTA Letm1 leucine zipper-EF-hand containing transmembrane protein 1 NM_019694 131 2023-2153 AGCTGGAGACCACTCAACAG GAGCTTGTGCTCTGGAATGT Letm2 leucine zipper-EF-hand containing transmembrane protein 2 NM_173012 100 1579-1678 GTGAAGCCAAAGCCTATTGA TGAGGTTCTCCTTTGACTCG Lias lipoic acid synthetase NM_024471 219 45-263 GACTCAAGCGACGAGTTGTT AGGTCTGGTCCATTATGCAA Lias lipoic acid synthetase NM_024471 199 137-335 CTCTACGCTGCTGGGATACA TGGCGCTTTAAGTTTCCTTT Lias lipoic acid synthetase NM_024471 205 323-527 ACTTAAAGCGCCAGAAAGGA ATCAACATGATCGTGGCTGT Lpar1 lysophosphatidic acid receptor 1 NM_010336 217 2042-2258 ATGAAGCTGTAGCGTTGTCC AGCAGGGAAAGATGGCTACT Lpar1 lysophosphatidic acid receptor 1 NM_010336 155 2650-2804 ACCATGCTGACAAAAAGCTC GAAAGGGATCACCAGTTCCT Lpar1 lysophosphatidic acid receptor 1 NM_010336 274 397-670 ATGGTGGCAATCTACGTCAA GGTTGCTCATTCGTGTATGG Lpl lipoprotein lipase NM_008509 156 2042-2197 TGGCATAAGTCAGGTCCATT GAGCCATGTCTTCAACTGCT Lrp1 low density lipoprotein receptor-related protein 1 NM_008512 214 8913-9126 ACCTGTGATGACCGTGAGTT TGTGGTCGTGACAGTCATTC Lrp1 low density lipoprotein receptor-related protein 1 NM_008512 202 12972-13173 ACCTGTCCCAATGGAAAGAG AGCACTGATCCAGCTCACAC Lrp1 low density lipoprotein receptor-related protein 1 NM_008512 183 13472-13654 ACCAAGGTGTGAGGTGAACA CACTCAGGCATCATCTTGCT Lrp6 lipoprotein receptor-related protein 6 NM_008514 192 3669-3860 CGTGTTTGAAAACTGGCTCT GAACAGCCACCATTATCCTG ltb4r1 leukotriene B4 receptor 1 NM_008519 227 360-586 TCCCTTTTTCCTCCACTTTC GAAAAGACACCACCCAGATG ltb4r1 leukotriene B4 receptor 1 NM_008519 170 48-217 GACCCTGGCACTAAGACAGA GAACAATGGGCAACAGAGAC ltb4r1 leukotriene B4 receptor 1 NM_008519 208 1040-1247 TCGTGGTCAAGCTACTGGAG GTGGGTCAGGCCAGAGTTAT ltb4r1 leukotriene B4 receptor 1 NM_008519 167 1168-1334 TCCTCCACCATTCCTGAGTC ATCCTGTCTCTCTGCCCTGA Ltb4r1 Leukotriene B4 receptor NM_008519 170 48-217 GACCCTGGCACTAAGACAGA GAACAATGGGCAACAGAGAC Ltb4r1 Leukotriene B4 receptor NM_008519 227 360-586 TCCCTTTTTCCTCCACTTTC GAAAAGACACCACCCAGATG Ltb4r1 Leukotriene B4 receptor NM_008519 157 124-280 GGAAACCCTGTCCTTTTGAT TCAGGATGCTCCACACTACA Ltb4r1 Leukotriene B4 receptor NM_008519 208 1040-1247 TCGTGGTCAAGCTACTGGAG GTGGGTCAGGCCAGAGTTAT Ltb4r2 leukotriene B4 receptor 2 NM_020490 151 825-975 CTTGGCTTTCTTCAGTTCCA CATGGTACCCTCCCTAGAGC Ltb4r2 leukotriene B4 receptor 2 NM_020490 238 64-301 ACCGGCACTGCTTTTCTACT ACACGTAGTACACCGCCTTG Ltb4r2 leukotriene B4 receptor 2 NM_020490 169 845-1013 GCGTCAACCCAGTGCTCTAT TGCCCCATTACTTTCAGCTT Ltb4r2 leukotriene B4 receptor 2 NM_020490 209 722-930 ACGCGGTCAATCTCCTACAG GCCCTCGAAGAGTCGAGTAA Ltb4r2 leukotriene B4 receptor 2 NM_020490 124 20-143 cgcctgggaatgagacacta cagcccgctaagctccatac Ltb4r2 leukotriene B4 receptor 2 NM_020490 71 20-90 cgcctgggaatgagacacta cgccagcagtagaaaagcag Ltbr lymphotoxin B receptor NM_010736 172 1831-2002 AAAGCTTTGTGGTGCTCATC ACATGCTAACGCTACCCAAG Mad2l1 MAD2 (mitotic arrest deficient, homolog)-like 1 NM_019499 209 867-1075 TGCACATTGTTAAGGGGAAT ACATTCCTGACTGACCCTCA Mad2l2 MAD2 mitotic arrest deficient-like 2 NM_027985 165 458-622 GGTTCAGATGTCCTGTCACC GGAGGCTGAGTGATCTCAAA Mad2l2 MAD2 mitotic arrest deficient-like 2 NM_027985 242 426-667 ATCTTCCAGAAGCGCAAGAA TGCTCCACATGAGACAGGAG Mad2l2 MAD2 mitotic arrest deficient-like 2 NM_027985 246 700-945 TGTGTGATGCTGTCCTGGAT GCCCTCAGCTGTTCTTATGC Malt1 mucosa associated lymphoid tissue lymphoma translocation gene 1 NM_172833 233 3887-4119 CTGAGGAAGACAGCCAGTGT GAGAGCAAGCCAGTAAGCAG Malt1 mucosa associated lymphoid tissue lymphoma translocation gene 1 NM_172833 236 528-763 CTTTGGAGCACACTGAGGTT GCAGACATAAAAGCCTGCAT Malt1 mucosa associated lymphoid tissue lymphoma translocation gene 1 NM_172833 181 1432-1612 CAGTTTCATGGTCCCTGTTG GACTTTCAGTGCGTCCAAGA Map1LC3A microtubule-associated protein 1 light chain 3 alpha NM_025735 191 589-779 TTTCAGTCCCCAGTGGATTA AAAATGACAAACCCCACAGA Map1LC3A microtubule-associated protein 1 light chain 3 alpha NM_025735 224 216-439 GACCAGCACCCCAGTAAGAT TAGATGTCAGCGATGGGTGT Map1LC3A microtubule-associated protein 1 light chain 3 alpha NM_025735 210 420-629 ACACCCATCGCTGACATCTA AGTGGGTGTCACATCTCTGC Map1LC3A microtubule-associated protein 1 light chain 3 alpha NM_025735 195 320-514 CATGAGCGAGTTGGTCAAGA TTGACTCAGAAGCCGAAGGT Map1LC3B microtubule-associated protein 1 light chain 3 beta NM_026160 212 590-801 AGTGCACTCAGCTTGGAAAC AGTGGGAGCCCTTTTAGAGA Map1LC3B microtubule-associated protein 1 light chain 3 beta NM_026160 207 63-269 GTCCGAGAAGACCTTCAAGC AAGCGCCGTCTGATTATCTT Map1LC3B microtubule-associated protein 1 light chain 3 beta NM_026160 177 1233-1409 GGATTTCCCCATTTCATGTC TGAGATCCTCAGACCACGAG Map1LC3B microtubule-associated protein 1 light chain 3 beta NM_026160 170 375-544 CGGCTTCCTGTACATGGTTT ATGTGGGTGCCTACGTTCTC Map1LC3B2 NO HOMOLOG Map1LC3C NO HOMOLOG Map2k1 mitogen-activated protein kinase kinase 1 NM_008927 179 1198-1376 GCCTCTCAGCTCATATGGAA GCTGCTTCAGATCTGCTCTC Map3k1 mitogen-activated protein kinase kinase kinase 1 NM_011945 239 2575-2813 CTATCGCGGATGAGGTAGAA TGAGCTGGGAAGTCCTACAG Marcks myristoylated alanine rich protein kinase C substrate NM_008538 198 2266-2463 CTGCAGTCATCTTGGACCTT AAACACGAGAGACGAGATGC Marcks myristoylated alanine rich protein kinase C substrate NM_008538 247 3152-3398 CTGCAAGCTTGGTTTTGTTT GAACTCCACCCTGCACTCTA Marcks myristoylated alanine rich protein kinase C substrate NM_008538 235 19-253 CCGCATCTTATTAGCAACCA CGAGGAGGACAGAAGAGACC Marcks myristoylated alanine rich protein kinase C substrate NM_008538 190 1565-1754 CAGCTTCCTCTGCCTTCTTT GTGGCCCCTATCACTTCATT Mcam melanoma cell adhesion molecule NM_023061 228 2155-2382 TTTAGAGACCAAGCCCTCCT GGTTCTCACAAGGACCAATG Mcl1 myeloid cell leukemia sequence 1 NM_008562 228 1149-1376 GGGGACTCTTAAAGCTCCAG TTTGCTGAGAGGGAACTTTG Mcm10 minichromosome maintenance deficient 10 NM_027290 237 3078-3314 TTTGCCTCTGTGTCTCCTTC AGCTGCAATCACAGTCAACA Mcm10 minichromosome maintenance deficient 10 NM_027290 154 2290-2443 AGCGTGTGGAGAATAGCAAC TCAGCCTCTTTCAGGATGTC Mcm10 minichromosome maintenance deficient 10 NM_027290 242 2602-2843 ATAACCTCCACTGGCACGAC GGCGGTGTCTGAAGAGAGTC Mcm2 minichromosome maintenance deficient 2 mitotin NM_008564 182 1365-1546 TAGAGCTGACCGGCATTTAC TTGCTGATCCTTGGAGAGAC Mcm3 minichromosome maintenance deficient 3 NM_008563 232 2523-2754 GATGGTGAGACGATCAGGAC ACCTCAAAGCTTCCTGGACT Mcm4 minichromosome maintenance deficient 4 homolog NM_008565 158 1629-1786 GGTGGAACAAGGAAGGATTT GAGCCTTTTCCAGACGTGTA Mcm4 minichromosome maintenance deficient 4 homolog NM_008565 176 2496-2671 GACCCTCGTACTGGCATTGT GTGTCAGACTGTCCCCGAAT Mcm4 minichromosome maintenance deficient 4 homolog NM_008565 241 1969-2209 CAAAGGCTGGGATCATCTGT TCCTCCACTTGCTCCTCACT Mcm5 minichromosome maintenance deficient 5 NM_008566 177 2718-2894 TTCAGCAGCACCTAATGTGA CTGAGGCCCACTTGCTATAA Mcm5 minichromosome maintenance deficient 5 NM_008566 195 2533-2727 GAGTCTGGAGCAGGAACAGG TGCTGCTGAAGAAAGCTGAA Mcm5 minichromosome maintenance deficient 5 NM_008566 178 1885-2062 CAGCATGAGAGGGACAGTGA ACAAAGCAGCATCCAGTGTG Mcpt1 mast cell protease 1 NM_008570 170 649-818 CTCTTCTGTGTGCTGGTGTG TCTGGCTTGGAGAATCTGTC Mcpt1 mast cell protease 1 NM_008570 217 786-1002 CTGACCAGCCTGAGACAGAT AGGTGCATTACAGGGAACAA Mcpt1 mast cell protease 1 NM_008570 172 261-432 GGAGCTCATGATGTGAGCAA GACCAGGCAAGGGAATTACA Mcpt2 mast cell protease 2 NM_008571 161 630-790 GAGATTCTGGGGGACCTCTA ACTCAGGCTGGTTAGGCTTT Mcpt2 mast cell protease 2 NM_008571 222 340-561 CCTTTCGGGTTTCTATGACA TGGTCTTTACAGGCCTCTTG Mcpt2 mast cell protease 2 NM_008571 170 56-225 GCACTTCTTTTGCCTTCTGG TGTGCAGCAGTCATCACAAA Mdm2 transformed mouse 3T3 cell double minute 2 NM_010786 192 1271-1462 CTGAAAAAGCCAAACTGGAA AAACAATGCTGCTGGAAGTC Med14 mediator complex subunit 14 NM_001048208 206 1079-1284 CGAGCTTTGGTTCATAGCAT GCATGGTATCTTTCCACCTG Meis1 Meis homeobox 1 NM_010789 249 1931-2182 CTACTTTGGACCAAGGAGCA TTCTGGAGGAAGTGAACAGC Meis1 Meis homeobox 1 NM_010789 226 782-1007 TGCTCGTCAGAGTCATTCAA TCACCAAATCGATAGGCATT Meis1 Meis homeobox 1 NM_010789 164 1285-1448 TCCCAAAGTAGCCACCAATA TGGGCTGCACTATTCTTCTC Met met proto-oncogene NM_008591 153 3995-4147 TTCACTGTCAAGGTTGCTGA CACATCTGACTTGGTGGTGA Mgp matrix Gla protein NM_008597 240 185-424 GGAGAAATGCCAACACCTTT CGAAACTCCACAACCAAATG Mgp matrix Gla protein NM_008597 217 323-539 CCATGGTCTACGGCTACAAC TTACTTTCAACCCGCAGAAG Mif Macrophage migration inhibitory factor (glycosylation-inhibiting factor) NM_010798 209 295-503 CCAGAACCGCAACTACAGTAA CCGGTGGATAAACACAGAAC Mki67 antigen identified by monoclonal antibody Ki 67 NM_001081117 164 5375-5538 CTCCACGAACCTCAAAGAGA TGTGGATTCCTTCACACCTT Mmp12 matrix metallopeptidase 12 NM_008605 166 1429-1594 CGTGTCACCAAAACATTGAA CACCTCCCCTTATTTCCTGT Mmp12 matrix metallopeptidase 12 NM_008605 190 1321-1510 ACACACTTCCCAGGAATCAA ACTGAAAAACCAGCAAGCAC Mmp12 matrix metallopeptidase 12 NM_008605 223 2143-2365 GTACCAAGCCATCAATGGAG GATGTGAAATGAGCCACACA Mmp12 matrix metallopeptidase 12 NM_008605 231 2040-2270 TGCTCCTGTGTCATCTCTCC GGAGTCATGTGCTGGCTAGA Mmp12 matrix metallopeptidase 12 NM_008605 213 389-601 GGATGAAGCGGTACCTCACT TACCACCTTTGCCATCAAAA Mmp12 matrix metallopeptidase 12 NM_008605 205 3050-3254 TTCAGGGACCTCATTTCACA AAAGGTCACGTGCTTTGTTG Mmp13 matrix metallopeptidase 13 NM_008607 152 880-1031 CCTTGATGCCATTACCAGTC GTTCATATGCAGCATCCACA Mmp13 matrix metallopeptidase 13 NM_008607 241 1396-1636 AGTCATGCCAACAAATTCCA TGGGGTTCTCAATTGCATTA Mmp13 matrix metallopeptidase 13 NM_008607 202 23-224 ATCCTGGCCACCTTCTTCTT TTTCTCGGAGCCTGTCAACT Mmp13 matrix metallopeptidase 13 NM_008607 190 662-851 TTTATTGTTGCTGCCCATGA TTTTGGGATGCTTAGGGTTG Mmp13 matrix metallopeptidase 13 NM_008607 181 1175-1355 TTTGAGAACACGGGGAAGAC TGGGCCCATTGAAAAAGTAG Mmp13 matrix metallopeptidase 13 NM_008607 152 880-1031 CCTTGATGCCATTACCAGTC GTTCATATGCAGCATCCACA Mmp13 matrix metallopeptidase 13 NM_008607 241 1396-1636 AGTCATGCCAACAAATTCCA TGGGGTTCTCAATTGCATTA Mmp13 matrix metallopeptidase 13 NM_008607 190 662-851 TTTATTGTTGCTGCCCATGA TTTTGGGATGCTTAGGGTTG Mmp13 matrix metallopeptidase 13 NM_008607 202 23-224 ATCCTGGCCACCTTCTTCTT TTTCTCGGAGCCTGTCAACT Mmp13 matrix metallopeptidase 13 NM_008607 181 1175-1355 TTTGAGAACACGGGGAAGAC TGGGCCCATTGAAAAAGTAG Mmp13 matrix metallopeptidase 13 NM_008607 197 1855-2051 GAGCCACAGATGAGCACAGA ATGTAAGGCCACCTCCACTG Mmp2 matrix metallopeptidase 2 NM_008610 227 2220-2446 GCTGGAGAACCAAAGTCTCA TCTTTGGGCACAAAAAGAAG Mmp2 matrix metallopeptidase 2 NM_008610 189 2703-2891 CACCTGGTTTCACCCTTTCT GAGGAGGGGAACCATCACTA Mmp2 matrix metallopeptidase 2 NM_008610 220 1884-2103 ACAGGAGGAGAAGGCTGTGT GGGGTCCATTTTCTTCTTCA Mmp2 matrix metallopeptidase 2 NM_008610 203 2327-2529 CACACCAGGTGAAGGATGTG AGGGCTGCATTGCAAATATC Mmp7 matrix metallopeptidase 7 NM_010810 221 31-251 CTCACCCTGTTCTGCTTTGT GGGGAGAGTTTTCCAGTCAT Mmp7 matrix metallopeptidase 7 NM_010810 221 499-719 GCAAGGAGAGATCATGGAGA ATCACAGTACCGGGAACAGA Mmp7 matrix metallopeptidase 7 NM_010810 164 706-869 CCCGGTACTGTGATGTACCC AATGGAGGACCCAGTGAGTG Mmp7 matrix metallopeptidase 7 NM_010810 194 113-306 ATCAGTGGGAACAGGCTCAG TTCTGCAACATCTGGCACTC Mmp9 matrix metallopeptidase 9 NM_013599 151 2936-3086 CTCACTCACTGTGGTTGCTG TGGTTATCCTTCCTGGATCA Mnat1 menage a trois 1 NM_008612 228 575-802 GAGGTAGAACGCCAAGAACA AATTCCTGTGGAAAACGTCA Mouse Cytokine Genes Mre11a meiotic recombination 11 homolog A NM_018736 164 1377-1540 GCTCATCACAAAACCTGCTT TGGCATCTTTCTCTTCCTTG Mre11a meiotic recombination 11 homolog A NM_018736 165 1067-1231 TTCTGGCTAACCACCCAAAC CCACCCGTAGTCGGATAAGA Mre11a meiotic recombination 11 homolog A NM_018736 156 461-616 ACCAGGATGGCAATCTCAAC CAACCTTCTCCACCGACATT Mta1 metastasis associated 1 NM_054081 157 579-735 AAAGGGGAAATTCGTGTAGG CCACCAGAAACTGGTCAATC Mta2 metastasis-associated gene family, member 2 NM_011842 212 1687-1898 ACAGAGCCACACTCAAGAGG GCATTGATAGGTGCATAGGG Mtpn myotrophin NM_008098 237 2220-2456 ACTAGCCTGCCCCTGTAGTT GGTCTCAAAACACCCTGTTG Muc1 mucin 1, transmembrane NM_013605 226 841-1066 CCTCCATCCAAAACATCAAG GGAATGATAGCTGAGCCTGA Mum1l1 melanoma associated antigen NM_175541 189 916-1104 AAAAGCATTAGGCGGAAAGA AATCAGTGACACGCACCAAT Mum1l1 melanoma associated antigen NM_175541 185 757-941 TCTTTAAATCCTGCCAGTGC TTCCTCTCTTTCCGCCTAAT Mx1 myxovirus (influenza virus) resistance 1 NM_010846 213 401-613 GAGGCAGTGGTATTGTCACC AGCTGACATCCAGGCTAATG Mx1 myxovirus (influenza virus) resistance 1 NM_010846 175 2896-3070 TGTAAGGCAAACCATTCCAT AGACACAGCTGAAAGGATGC Mx1 myxovirus (influenza virus) resistance 1 NM_010846 187 1818-2004 GTTTCCTCAAAAGGGGTTGA CCAGCTGCACTTACTGGTGT Mx1 myxovirus (influenza virus) resistance 1 NM_010846 213 2004-2216 GTTCCTGGAGGAGCAGAGTG TACAAAGGGCTTGCTTGCTT Myb myeloblastosis oncogene NM_010848 180 1350-1529 GGCTCCCTACCTGAAGAAAG GGAGGGTAAGGTAGGTGCAT Myc myelocytomatosis oncogene NM_010849 226 758-983 GCCCAGTGAGGATATCTGGA ATCGCAGATGAAGCTCTGGT Myc myelocytomatosis oncogene NM_010849 157 1203-1359 TCAGTGGTCTTTCCCTACCC GTGTCTCCTCATGCAGCACT Myc myelocytomatosis oncogene NM_010849 165 1885-2049 TGAGGAAACGACGAGAACAG GGCTTTGAGCATGCATTTTA Myc myelocytomatosis oncogene NM_010849 247 490-736 GGGGAGGGAATTTTTGTCTA TGCTGTTGCTGGTGATAGAA Myc myelocytomatosis oncogene NM_010849 247 490-736 GGGGAGGGAATTTTTGTCTA TGCTGTTGCTGGTGATAGAA Mycn v-myc myelocytomatosis viral related oncogene, neuroblastoma derived NM_008709 221 1066-1286 TTGAGCGACTCAGATGATGA GCATAGTTGTGCTGCTGATG Mycn v-myc myelocytomatosis viral related oncogene, neuroblastoma derived NM_008709 230 1165-1394 GCGGTAACCACTTTCACGAT CTCTTCGCTTTTGCTGGAAC Mycn v-myc myelocytomatosis viral related oncogene, neuroblastoma derived NM_008709 206 1518-1723 GCTGGTGAAGAACGAGAAGG AAATGTGCAAAGTGGCAGTG Myd88 myeloid differentiation primary response gene 88 NM_010851 170 450-619 GGAGTCCGAGAAGCCTTTAC GGATCATCTCCTGCACAAAC Myot myotilin NM_001033621 206 834-1039 GGTTGTTAGGACCGCAGAAT TTCTGGCACTTGAATGAAGC Myot myotilin NM_001033621 181 1196-1376 TTCGAAGTGGTCAGAGCATC ACTCCAGCTTCACGGTCTCT Nab2 Ngfi-A binding protein 2 NM_008668 214 1964-2177 ATGGGGCTTCAAGCAATAAC GTTCAGCTGCTCACACCACT Nab2 Ngfi-A binding protein 2 NM_008668 177 978-1154 GTGGTGGAGAGTGTGGAGAG GCCGTAGATGACGCTGTACT Nab2 Ngfi-A binding protein 2 NM_008668 192 714-905 AGCTTTAGCCCCAAGAGTCC AGGCCCTTCAGAGACTCCTC Naip1 NLR family, apoptosis inhibitory protein 1 NM_008670 172 2625-2796 CCCGAATAATGAAGGGACTT AAAGCCAGTGTTCTCCCTCT Naip2 NLR family, apoptosis inhibitory protein 2 NM_010872 230 454-683 GTGAAACTTGGGGTTCAGTG TCAAAGGACTCCAGTCTTGC Naip2 NLR family, apoptosis inhibitory protein 2 NM_010872 236 2724-2959 agcgccaacagttgtatctc gagaacatgcagcaactgtg Naip2 NLR family, apoptosis inhibitory protein 2 NM_010872 199 629-827 tgagaggtgacaaagcaagg ttccagggatcatctccttc Nbn nibrin NM_013752 186 701-886 ACCCATTGATGAACCAGCTA TGTTCCTCTTCGTCGTCTTC Nbn nibrin NM_013752 204 1840-2043 TTGAAAAGCAGGAGGCAGAT CACTGCTGTCCTGAAGACCA Nbn nibrin NM_013752 208 1526-1733 AGAGCTGTCCTCGTGCAAAT TTCTGTGGGAAGTGGTTTCC Ncam1 neural cell adhesion molecule 1 NM_001081445 159 3022-3180 ACGCACACACAAACACATTC GGCTGTGGGTTTAACCTTTT Neo1 neogenin NM_008684 113 5777-5889 TTAGCTGCCCTGGTATCTTG CACAGTCAGGCTCTGGTTCT Neo1 neogenin NM_008684 136 6069-6204 AAACATCAACCAGGGTGAGA GAGCTGCTGGGATAGATGAA Neo1 neogenin NM_008684 279 737-1015 GCCACTGTGGATAATCTTGG AACAATGCAGCGGTAGAGTC Nfe2l2 nuclear factor, erythroid derived 2, like 2 NM_010902 231 1753-1983 GGAAAAGGAAGCTGGAGAAC ACACATTGCCATCTCTGGTT Nfe2l2 nuclear factor, erythroid derived 2, like 2 NM_010902 175 1449-1623 AGTGCTCCTATGCGTGAATC TTTCGACAGGGAATGGAATA Nfe2l2 nuclear factor, erythroid derived 2, like 2 NM_010902 187 905-1091 GATCTCCTCGCTGGAAAAAG GTCACTGGGCTCTGCTATGA Nfe2l2 nuclear factor, erythroid derived 2, like 2 NM_010902 231 1139-1369 ACTCCTGGACGGGACTATTG ACACTTCCAGGGGCACTATC Nfkb1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1, p105 NM_008689 242 1254-1495 TGAGAATGGACAGAACAGCA AAGCTGAACAAACACGGAAG Nfkb2 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2, p49/p100 NM_019408 164 1016-1179 TGCTCTGTGATAAGGTGCAA AGGCCTCTCGATCTTCATCT Nfkb2 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2, p49/p100 NM_019408 220 2135-2354 ACTGTGGAGCTGAAGTGGAG ATGTCAGCACCAGCCTTTAG Nfkb2 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2, p49/p100 NM_019408 270 2843-3112 CCAGCACAGAGGTGAAAGAA GGGGTTGCTGTACCGTAAGT Nfkb2 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2, p49/p100 NM_019408 179 2266-2444 ACCTTTGCTGGAAACACACC GTATCCCTCTCAGGCCCTTC Nfkb2 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2, p49/p100 NM_019408 164 2191-2354 CTAGCCACAGAGATGGAGGA ATGTCAGCACCAGCCTTTAG Nfkb2 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2, p49/p100 NM_019408 169 412-580 AAACAGCGAGGCTTCAGATT GAGGTGGGTCACTGTGTGTC Nfkb2 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2, p49/p100 NM_019408 164 1016-1179 TGCTCTGTGATAAGGTGCAA AGGCCTCTCGATCTTCATCT Nfkb2 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2, p49/p100 NM_019408 169 412-580 AAACAGCGAGGCTTCAGATT GAGGTGGGTCACTGTGTGTC Nfkb2 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2, p49/p100 NM_019408 153 2133-2285 TGACTGTGGAGCTGAAGTGG GGTGTGTTTCCAGCAAAGGT Nfkb2 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2, p49/p100 NM_019408 179 2266-2444 ACCTTTGCTGGAAACACACC GTATCCCTCTCAGGCCCTTC Nfkb2 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2, p49/p100 NM_019408 217 2843-3059 CCAGCACAGAGGTGAAAGAA GAGATGTGGGCTTGAGGTTT Nfkb2 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2, p49/p100 NM_019408 220 2135-2354 ACTGTGGAGCTGAAGTGGAG ATGTCAGCACCAGCCTTTAG Nfkbia nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha NM_010907 235 181-415 ACGAGGAGTACGAGCAAATG AAGTGGAGTGGAGTCTGCTG Nfkbia nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha NM_010907 235 390-624 AACCTGCAGCAGACTCCACT GACACGTGTGGCCATTGTAG Nfkbia nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha NM_010907 181 759-939 CTGGTTTCGCTCTTGTTGAA CCGTGTCATAGCTCTCCTCA Nfkbia nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha NM_010907 243 536-778 GGCCAGTGTAGCAGTCTTGA TTCAACAAGAGCGAAACCAG Ngb neuroglobin NM_022414 198 1095-1292 GCCAAGCTGTTTACTTTCCA GTTAGGTTTCCCCCAAAAGA Ngb neuroglobin NM_022414 243 1287-1529 CCTAACTGGCCAGCCATAAT GGGCCCTCCCTACTCTATTC Ngb neuroglobin NM_022414 190 1300-1489 CCATAATGGAGAGGCCAGAA GCACGAGTACACCTCAAGCA Ngb neuroglobin NM_022414 239 513-751 CGTGGAGGACCTGTCTTCAT GGCACTGGCTCGTCTCTTAC Nlrp12 NLR family, pyrin domain containing 12, mRNA BC116252 233 1980-2212 ACAAAGATGGAGCACATGGT GTATAAGGCCAGCTCGATCA Nlrp12 NLR family, pyrin domain containing 12, mRNA BC116252 199 1076-1274 CCAGGTCTCTCTGCTCATCA CATGGTAAAGAGGGGCTCAT Nlrp12 NLR family, pyrin domain containing 12, mRNA BC116252 134 2010-2143 TGTGCGAGGTATTGCAGAAG AGGCAGCAAGTTCCTTTCAA Nlrp12 NLR family, pyrin domain containing 12, mRNA BC116252 238 1414-1651 CAGGGACTCCAACCTTCAAA CAGTACATGGCTGCGAAGAA Nlrp12 NLR family, pyrin domain containing 12, mRNA BC116252 164 1276-1439 GTTTTGTTCCCATGGTGTCC TGGGACTTTGAAGGTTGGAG Nlrp12 NLR family, pyrin domain containing 12, mRNA BC116252 170 609-778 GTAGAGTGGGAACGCTCCAG GCCCAGTCCAACATCACTTT Nme4 non-metastatic cells 4 NM_019731 235 287-521 AGCCATTCTACCCAGCTCTT CTCTGAAACCACAGCTCGAT Nmnat3 nicotinamide nucleotide adenylyltransferase 3 NM_144533 176 1366-1541 TGTGTAAATGGCAGTCATGG TCAGTAATTAGCGCCCTGTC Nmnat3 nicotinamide nucleotide adenylyltransferase 3 NM_144533 237 881-1117 ACACGCACATCCAGGAAATA CCCTGATGTAGGTGATGACG NMYC v-myc myelocytomatosis viral related oncogene, neuroblastoma derived NM_008709 TTGAGCGACTCAGATGATGA ACAGCGCTTGAGGATCAGCT NMYC v-myc myelocytomatosis viral related oncogene, neuroblastoma derived NM_008709 191 GGAAGAAGTTTGAGCTGCTG AAGGATGACCGGATTAGGAG Nod1 nucleotide-binding oligomerization domain containing 1 NM_172729 153 3023-3175 TGCAGAAGAACACAGCCATA CTGTGACTGAGGAGCAACCT Nos1 nitric oxide synthase 1 NM_008712 152 410-561 TACACACCTGGAGACCACCT GACCTGGGACCCTGTCTACT Nos1 nitric oxide synthase 1 NM_008712 185 3687-3904 TACCATACCCGAGATGGAGA TGTTGGATGTCAAATTGTCG Nos1 nitric oxide synthase 1 NM_008712 124 2758-2881 GGGCATACCCTCACTTCTGT CTGAAAGCCTCTTCCTGTCC Nos2 nitric oxide synthase 2, inducible NM_010927 247 3042-3288 CTTTGTGCGAAGTGTCAGTG CACCTGGAACAGCACTCTCT Nos2 nitric oxide synthase 2, inducible NM_010927 191 1729-1919 GTGTTCTTTGCTTCCATGCT AGTTGCTCCTCTTCCAAGGT Nos2 nitric oxide synthase 2, inducible NM_010927 214 3652-3865 AGATAATGGTGAGGGGCTTG GGAAGAGTGAGAGGCAAAGG Nos2 nitric oxide synthase 2, inducible NM_010927 170 1011-1180 CACCTTGGAGTTCACCCAGT ACCACTCGTACTTGGGATGC Nos3 nitric oxide synthase 3 NM_008713 190 590-779 AAGCTGCAGGTATTTGATGC TATAGCCCGCATAGCGTATC Nos3 nitric oxide synthase 3 NM_008713 242 3167-3408 TCCCAACTGGACCATCTCTA AGAATTCTCTGCACGGTTTG Nos3 nitric oxide synthase 3 NM_008713 209 1121-1329 GACCCTCACCGCTACAACAT CTGGCCTTCTGCTCATTTTC Nqo1 NAD(P)H dehydrogenase, quinone 1 NM_008706 214 301-514 CACAGGTGAGCTGAAGGACT GTAGGCAAATCCTGCTACGA Nqo1 NAD(P)H dehydrogenase, quinone 1 171 231-401 GAGGATGGGAGGTACTCGAA TGTGTTCGGCCACAATATCT Nrgn neurogranin NM_022029 177 877-1053 CAACCACCAAGTCCTTTCGT CAGGCAGGTATGGGATAGGA Nrgn neurogranin NM_022029 226 223-448 CCAAGCCAGACGACGATATT AAACGTTCAGCTCTGGCCTA Nrgn neurogranin NM_022029 245 426-670 GACTAGGCCAGAGCTGAACG GGCAAAAGGAGACCACGTTA Nrgn neurogranin NM_022029 222 1005-1226 AATTTCCCTTGCTCAAATGG AAAAACCTTCCAGCCACAAC Nrgn neurogranin NM_022029 189 314-502 CATGGCGAGGAAGAAGATAA AAGTCTTGTCACTGCGAAGG Nrgn neurogranin NM_022029 202 53-254 AAGAGGAGAGAGGCTGGTTC CGGGATGTCAAGAATATCGT Ntn1 netrin 1 NM_008744 208 3015-3222 CTCACAGCAATGTCAACAGC GCAGGAAGCAGTCACAGAAT Ntn1 netrin 1 NM_008744 154 2883-3036 TCCCAGAGAGTTTCCTTGCT CAGCTGTTGACATTGCTGTG Ntn1 netrin 1 NM_008744 178 4658-4835 AAGGGGGAAGAAGACATCCT ACCCAAATGGTAAGCAAAGG Ntn1 netrin 1 NM_008744 249 1716-1964 TCCAAAGGCAAGCTGAAGAT GGCATTACCCAACAGCAAGT Odc1 ornithine decarboxylase, structural 1 NM_013614 203 896-1098 TGTCTGTCGCCTCAGTGTTA GCATGCTGAAACCAACTTCT Odc1 ornithine decarboxylase, structural 1 NM_013614 195 2274-2468 TGCCCTCTCTGTACAGCATC ATTGGGAGTCAAGGGTTGAG Odc1 ornithine decarboxylase, structural 1 NM_013614 175 1649-1823 GTGGCAACTCATGAAGCAGA TGCAGGCAAGAGCTACAAGA Olfr133 olfactory receptor 133 NM_146831 181 124-304 AACATTGCCATCATTCTCGT AAAGCTGAACTGCACACCTC Olfr133 olfactory receptor 133 NM_146831 205 276-480 CAGCTACATGAGGTGTGCAG GGCCTCTGAGACAGCATAGA Olfr133 olfactory receptor 133 NM_146831 242 488-729 CACTGCAATTGCCTCTTTGT AGAGGAACATGTCCCAAAGG Olfr133 olfactory receptor 133 NM_146831 225 100-324 ACATACCCCACAGCCATGAT CCCCATTGTGTGGAAGAAAT Olfr1507 olfactory receptor 1507 NM_020512 226 290-515 TTGATGACTGTGTGGTCCAG CAGTAAGGCAGCTTGATGGT Olfr1507 olfactory receptor 1507 NM_020512 216 225-440 CCATTCCACTGTCACTGTCC AGCACCATACACACCTTCCA Olfr1507 olfactory receptor 1507 NM_020512 153 694-846 ATCTCTGACGGCAAGAGGAA GGTTATGGCCGTGAAAAATG Olfr1507 olfactory receptor 1507 NM_020512 167 168-334 CCGACTCCATACTCCCATGT AGGCAAAGAGATGCAGGAAA Olfr1507 olfactory receptor 1507 NM_020512 212 373-584 CGCTATGTGGCCATTTGTAA GTGTCAGTGCAAGCCAGTTC Olfr1507 olfactory receptor 1507 NM_020512 203 488-690 CCTCACTCACCATCAAGCTG TTGCCTCAGACTCACAAGGA Pak1 p21 (CDKN1A)-activated kinase 1 NM_011035 153 1583-1735 GGCAATTGAAATGATTGAGG ATCTCAAGACAGCGGTTCAG Pak1 p21 (CDKN1A)-activated kinase 1 NM_011035 199 1330-1528 TGTGCCGAGAGTGTCTACAA ACTTCAGGTGCCATCCAATA Pak1 p21 (CDKN1A)-activated kinase 1 NM_011035 156 2836-2991 CTCTGCAAGTGGACATGCTT CATGACAAGGTAGGCAATGG Pak1 p21 (CDKN1A)-activated kinase 1 NM_011035 169 1105-1273 AGGAGGTGGCCATTAAACAG CCTCCAGCCAAGTATTCCAT Pax4 paired box gene 4 NM_011038 209 165-373 AGTTGGCTTCCTGTCCTTCT TTGCTCACACAGCCATTAGA Pax4 paired box gene 4 NM_011038 198 891-1088 GAGAAGCTGAAATGGGAAGC GGTGTCACTGGAACATCTGC Pax4 paired box gene 4 NM_011038 217 463-679 CTCGAATTGCCCAGCTAAAG TTACTGTGGGGACTGGGAAG Pax4 paired box gene 4 NM_011038 236 823-1058 CCACCTCTCTGCCTGAAGAC CCCACAGCATAGCTGACAGA Pax4 paired box gene 4 NM_011038 192 226-417 GCAGTGTGAATCAGCTAGGG ACTTGGGTTCCAAGACACCT Pax8 paired box gene 8 NM_011040 188 1981-2168 CCAAGGCTCTACGTGTCAGT GAGCCTCACTGAACTTTCCA Pax8 paired box gene 8 NM_011040 209 348-556 CCTTGGCAGGTACTACGAGA TTCTGTTGATGGAGCTGACA Pax8 paired box gene 8 NM_011040 221 953-1173 ACCCACTGCCCTTACTCAAC GACTTGCTGCAGATCCAAAA Pbef1 pre-B-cell colony-enhancing factor 1 NM_021524 203 1274-1476 CCTCTTGAATTGCTCCTTCA CCGTATGGAGAAGATCATGG Pbsn probasin NM_017471 190 11-200 CTCACACATGATGAGGGTCA TCTCCTCCCACACAAAATGT Pbsn probasin NM_017471 297 181-477 acattttgtgtgggaggaga tgcccatttcttccactaag Pbsn probasin NM_017471 277 125-401 tgccagtaccatggaaaaga agccactcgtgtgacatcat Pbsn probasin NM_017471 166 31-196 tcatcctcctgctcacactg ctcccacacaaaatgtgacg Pcdh7 protocadherin 7 NM_001122758 225 1280-1504 TTCAGCCTTGAGTCTGGTTC CGTGTTATCGTTGATGTCCA Pcdh7 protocadherin 7 NM_001122758 214 4086-4299 CATTGCCTACTGTCCAGCTT TGAGGCTGACTCACAACAGA Pcdh7 protocadherin 7 NM_001122758 165 2811-2975 CCTCAGTGATGGGGACTTTT CAGCCACCTGTACAATCACC Pcdh7 protocadherin 7 NM_001122758 218 3294-3511 ACAACGCTCCCACAGTTACC CTGGGTGAGTTTCCCCACTA Pcna proliferating cell nuclear antigen NM_011045 194 784-977 TTTTTCACAAAAGCCACTCC TCAGGAGCAATCTTCAAAGG Pcna proliferating cell nuclear antigen NM_011045 172 23-194 GGGTTGGTAGTTGTCGCTGT TCCAGCACCTTCTTCAGGAT Pcna proliferating cell nuclear antigen NM_011045 208 600-807 CCACATTGGAGATGCTGTTG CAGTGGAGTGGCTTTTGTGA Pde3a phosphodiesterase 3A, cGMP inhibited NM_018779 172 2319-2490 CCTGGACAAACCAATTCTTG CCCCATGTCTTCAAACAGTC Pde3a phosphodiesterase 3A, cGMP inhibited NM_018779 184 3446-3629 AGGAGGAAGAGGCTGAAACA GACTGGTTCTCTGTGCCTGA Pde3a phosphodiesterase 3A, cGMP inhibited NM_018779 175 1773-1947 GACGACTCTCACCAAAAGCA ACTGTTGCTGACAGGACTGC Pde3a phosphodiesterase 3A, cGMP inhibited NM_018779 175 2094-2268 ttattcgcaagggaatcctg gggttctctctggcactcag Pde3a phosphodiesterase 3A, cGMP inhibited NM_018779 164 3693-3856 agagaaggggaagccaagag ccatttgccaatcttctggt Pde3a phosphodiesterase 3A, cGMP inhibited NM_018779 177 3122-3298 atgaaaacgaccgtctcctg agcggtccataaagggactt Pde3a phosphodiesterase 3A, cGMP inhibited NM_018779 169 1969-2137 tcccctgaagtaaccatcaa cacttctctctgagggtcca Pdgfa platelet derived growth factor, alpha NM_008808 236 656-891 CAGGAAGAAGCCAAAATTGA TTTCACGGAGGAGAACAAAG Pdgfa platelet derived growth factor, alpha NM_008808 161 700-860 AACACCTGGAGTGTGCATGT ATTGGCAATGAAGCACCATA Pdgfa platelet derived growth factor, alpha NM_008808 244 476-719 CAGGACGGTCATTTACGAGA ACATGCACACTCCAGGTGTT Pdgfa platelet derived growth factor, alpha NM_008808 223 252-474 GAGATACCCCGGGAGTTGAT TCTTGCAAACTGCAGGAATG Pdgfb platelet derived growth factor, B polypeptide NM_011057 190 2153-2342 TACGTTCACTTCCGGTTCAT CCCATTACAACCTTGCTCAC Pdlim5 PDZ and LIM domain 5 NM_019808 170 192-361 TTTCAACATGCCTCTGACAA TCATATTCAAGGAGCCCGTA Pdlim5 PDZ and LIM domain 5 NM_019808 151 179-329 AAGGTGGCAAGGATTTCAAC TTGTTCTGGGCTTCAAGATG Pdlim5 PDZ and LIM domain 5 NM_019808 179 1580-1758 TCAATGCTTTGAAGCAGACC CATGTCACCAGCCTCTATGG Pdlim5 PDZ and LIM domain 5 NM_019808 239 259-497 ATAGGGGACGTGGTTCTCAG TAGGCCATGTTGGTAGTGGA Pdlim5 PDZ and LIM domain 5 NM_019808 200 989-1188 TCACTGGGACTGAGCATCTG GGTGGATCCTACAGGCTTGA Pdx1 pancreatic and duodenal homeobox 1 NM_008814 172 1109-1280 CTGGCAGACTTCTGGAAAAA CGTATTGGAACGCTCAAGTT Pif1 PIF1 5'-to-3' DNA helicase homolog NM_172453 205 CTCCCATGCAATCCATCTCT ATGTTTACTTGGGGCTGTGC Pif1 PIF1 5'-to-3' DNA helicase homolog NM_172453 297 GAGGGGTGGTAGTTGGGTTT CAAAGTCCAGCACACGAAGA Pif1 PIF1 5'-to-3' DNA helicase homolog NM_172453 252 TCGCTGGGAGAGGTACAGAT GGGGACTCGTTAGGGACTTC Pif1 PIF1 5'-to-3' DNA helicase homolog NM_172453 223 CCAGGGTCGGTTCTAATTTT CATCCTCTGTGCCTGTCTCT Pif1 PIF1 5'-to-3' DNA helicase homolog NM_172453 190 3270-3459 ATGAGAGACAGGCACAGAGG TGCCATAGTTTGGATGGTTT Pif1 PIF1 5'-to-3' DNA helicase homolog NM_172453 177 94-270 GGTACAGATTCGTGGGTCAG GAGACTGGCTGGAAGTGAAA Pik3c3 phosphoinositide-3-kinase, class 3 NM_181414 212 1731-1942 TGCAGAGAGAAAGTGGGAAC GCCTCCATCTTCAGTCTTGA Pik3r1 phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 1 NM_001024955 218 1641-1858 TATCAACACACCTCCCTCGT AGCTCTAGTCCCATGTGCAG Pik3r4 phosphatidylinositol 3 kinase, regulatory subunit, polypeptide 4, p150 NM_001081309 204 4431-4634 ATCACAGACATTGCCACCTT TGCTCAGCCATGAAACAGTA Pla2g4a phospholipase A2, group IVA NM_008869 239 572-810 GTTTGTTCATGCCCAGACCT ATCCCCGACTCATACAGTGC Pla2g4a phospholipase A2, group IVA NM_008869 196 1138-1333 GCCTCTCTTCACGTGTCTCC ACCCATCAAGAAATGCAAGG Pla2g4a phospholipase A2, group IVA NM_008869 205 1247-1451 ATGGCTCCTGACCTATTTGG TCACGATGTGCTTTGCTGTA Pla2g4a phospholipase A2, group IVA NM_008869 221 928-1148 GAAAAATGTCAGCCACAACC TGAAGAGAGGCAAAGGACAC Pla2g4c phospholipase A2, group IVC NM_001004762 207 794-1000 GGGAAGTGCTTTTGCTGATA AGGGCACAGAGCTTATCCTT Pla2g4c phospholipase A2, group IVC NM_001004762 212 896-1107 CTCAGAAGCACCAAGGATGA GGTCGAGAAACTGCTCCTTC Pla2g4c phospholipase A2, group IVC NM_001004762 170 102-271 GCCACTAGACTCCAGGAAGC TCACTCAGCACACCAAGACA Pla2g4c phospholipase A2, group IVC NM_001004762 193 1804-1906 TAAAGGATCCCCAAGGCTCT GTAGGCCCACAGTACCCTGA Pla2g4c phospholipase A2, group IVC NM_001004762 245 1213-1457 CTCGCAAGTGTGTCTCCAAA TTGGCAGTAGTCTGCTGTGG Pla2g4c phospholipase A2, group IVC NM_001004762 151 426-576 CATGAGAGCCTGGAGAAAGC GCACTCCTTCTTCCACTTGC Pla2g4c phospholipase A2, group IVC NM_001004762 199 951-1149 AACAACCAACCAAAGAACCA TGTCCCAGTAGCTGAAGAGG Pla2g4c phospholipase A2, group IVC NM_001004762 183 2719-2901 TGAGCCTCCACGCTATTTAC GTTGTCTTGGGCTAGAAGCA Pla2g4c phospholipase A2, group IVC NM_001004762 209 2086-2304 TTCAGTACCGAGCAGTCTCC CCTCTGTCTGTCCCTCTGAA Plau plasminogen activator, urokinase NM_008873 186 890-1075 ATTGCCTTGCTGAAGATACG TACGACGGACATTTTCAGGT Plau plasminogen activator, urokinase NM_008873 161 146-306 TCAAACTGTGGCTGTCAGAA GCCTTTCCTCGGTAAGAGTC Plau plasminogen activator, urokinase NM_008873 160 1463-1622 GACAGGTTTTGCATTGATCC AAAAAGGCAACTCCTGGTCT Plau plasminogen activator, urokinase NM_008873 232 349-580 GCCTGCTGTCCTTCAGAAAC TAGAGCCTTCTGGCCACACT Plaur plasminogen activator, urokinase receptor NM_011113 228 559-786 CCAGACCTTTCACTTCCTGA ACGGTATAACTCCGGTTTCC Plaur plasminogen activator, urokinase receptor NM_011113 219 726-944 CAATGAATCAGTGCCTGGTG CAATGAGGCTGAGTTGAGCA Plaur plasminogen activator, urokinase receptor NM_011113 206 1070-1275 GTGCCCTCGTGTTGTCTTCT GTGGGGAGACCCAACCTTAT Plaur plasminogen activator, urokinase receptor NM_011113 241 267-507 TCATCAGCCTGACAGAGACC CGGGTGTAGTCCTCATCCTT Plaur plasminogen activator, urokinase receptor NM_011113 178 695-872 GAAGAGGCGTCTCTCATCAA AGCAGGAGACAGAGACGTTG Plaur plasminogen activator, urokinase receptor NM_011113 202 479-680 AGGAGCTTGAAGGATGAGGA GGGTATTGTTCCCCTCACAG Plaur plasminogen activator, urokinase receptor NM_011113 153 423-575 AATGCCGCTATCCTACAGAG GGAAGTGAAAGGTCTGGTTG Pltp phospholipid transfer protein NM_011125 219 1532-1750 AAAGGGCTTCGAGAAGTGAT ATAGCTTCCAACTGGGCTCT Pmm1 phosphomannomutase 1 NM_013872 242 944-1185 CCAACACGTAGCATCCTGTG CCTTCTCTGCCATTCTGTCC Pmm1 phosphomannomutase 1 NM_013872 218 670-887 ACAGCCTGGATGAAGACAGC CTCTTTGAAGGTCCCAGTGC Pmm1 phosphomannomutase 1 NM_013872 246 808-1053 GATGCCGTGAGCTCTTCTTC AGAGCAGGTATGCGTCTCGT Pmm1 phosphomannomutase 1 NM_013872 215 342-556 CAGACGATCCAGAACCACCT TTCTCCCGGATCTTCTCCTT Pnrc1 proline-rich nuclear receptor coactivator 1 NM_001033225 214 1112-1325 CAGAAGTGAGCCAAAAGGAA TCTGGGGAAATCGATGTTTA Pnrc1 proline-rich nuclear receptor coactivator 1 NM_001033225 166 855-1020 GATGGGAAAATCGGAGAAAA AGCAGAATCCTGCCAAAAGT Pnrc1 proline-rich nuclear receptor coactivator 1 NM_001033225 213 1148-1360 AGTTCAGTGACCCACCTTCC TCACTGCTGTATCCGTTTCC Pou3f4 POU domain, class 3, transcription factor 4 NM_008901 230 674-903 ACGTGTTCTCGCAGACTACC GGGACACTTGAGGAAATGTG Pou3f4 POU domain, class 3, transcription factor 4 NM_008901 245 730-974 AACATGTGCAAGCTGAAACC CAGACACGCACCACTTCTTT Ppm1a protein phosphatase 1A, magnesium dependent, alpha isoform NM_008910 167 69-235 GCCAAAGATGGAGAAGCATA CATGCCCATCATATACAGCA Ppm1k protein phosphatase 1K NM_175523 225 897-1121 TGACCATACCCCAGAAAGAA CCATCTGTGGTAAGGACCAG Ppm1k protein phosphatase 1K NM_175523 196 4175-4370 TAGATGAAGGCGAGTTCCAG AGAATCAGGCATGAAAGCAG Ppm1k protein phosphatase 1K NM_175523 224 1972-2195 TTCCAAGGGAGGGATACAAG GGATGGGGAAGTGCTAAAAA Prelid2 PRELI domain containing 2 NM_029942 183 484-666 AGCCCAGAAGGGAATTAGAA CCCTCTGACTCTGTCCTGAA Prelid2 PRELI domain containing 2 NM_029942 178 402-579 AAACAGGCCGAATTTCAATC AGTGGCAGCTTCCTGATTTT Prelid2 PRELI domain containing 2 NM_029942 168 333-500 ATGCATCCATGAGGGAAGAG TAATTCCCTTCTGGGCTCCT Prf1 perforin 1 (pore forming protein) NM_011073 198 1433-1630 GGTGGACTGACAAGATGGAC GACACTTGGCATGGTAGGAG Prf1 perforin 1 (pore forming protein) NM_011073 201 CAAGGTAGCCAATTTTGCAG TAGGAGGAGATGAGCCTGTG Prom1 prominin 1 NM_008935 105 173-277 GATCAGGCCAACAACTATGG CCAGGAGTGTTATGGAATGC Prom1 prominin 1 NM_008935 141 2506-2646 ATGGCATTCTGTGTGGCTAT CATCCTCTGAATCCATCCTG Prom1 prominin 1 NM_008935 225 1029-1253 ACCAACCTGAGCTCTGTGAG TGTCGTATACCCCCTTTTGA Prtn3 proteinase 3 NM_011178 232 647-878 GCATTCTTCATGGAGTGGAC GAAAGAAAAGCCTGGAAAGG Prtn3 proteinase 3 NM_011178 175 95-269 AGATTGTAGGTGGGCACGAG AGCACCACTGTCACAAGCTG Ptafr platelet-activating factor receptor NM_001081211 250 431-680 CACTATGGCTGACCTGCTCT CCAAATGATCAGGGACAAAG Ptafr platelet-activating factor receptor NM_001081211 158 291-448 TTTCGATACACGCTCTTTCC AGCAGGTCAGCCATAGTGAG Ptafr platelet-activating factor receptor NM_001081211 249 792-1040 TACAGTGTGCCCATCCTTGT GTAGCCCAACTCTGCTAGGG Ptafr platelet-activating factor receptor NM_001081211 187 701-887 ATCCTATTTCCTGGCCACAG GTGGATGATGACCAAGTTGC Pten phosphatase and tensin homolog NM_008960 246 3696-3941 ACAAAGGATCTCCTCCCAAC TGGCGTTCTGCCTAATCTAC Ptgs2 prostaglandin-endoperoxide synthase 2 NM_011198 219 31-249 AAGGAACTCAGCACTGCATC TAGAATCCAGTCCGGGTACA Ptgs2 prostaglandin-endoperoxide synthase 2 NM_011198 229 1089-1317 TGATCGAAGACTACGTGCAA GTGAGTCCATGTTCCAGGAG Ptgs2 prostaglandin-endoperoxide synthase 2 NM_011198 227 3042-3268 TTGAACCTGGACTGCAGAAG TCCTGAGCTGAGGTTTTCCT Ptgs2 prostaglandin-endoperoxide synthase 2 NM_011198 194 1509-1702 AGAAGGAAATGGCTGCAGAA GCTCGGCTTCCAGTATTGAG Rab28 RAB28, member RAS oncogene family NM_027295 226 398-623 AGGTGGCAAGATGTTGGATA CTGGCAAAATCGTAAGTGCT Rab28 RAB28, member RAS oncogene family NM_027295 207 1067-1273 TTGAGACTGCCTCCTCACTC TCAATAGCCAGCAAAGGAAC Rab28 RAB28, member RAS oncogene family NM_027295 218 1029-1246 CACGTTTTGAAATCCGAATG TGAGAGGCTTTCACCATCAG Rad1 RAD1 homolog NM_011232 175 1242-1416 GCCTCGAACTCAGAAATTCA TGCTCCTATTTTCTCCATGC Rad1 RAD1 homolog NM_011232 162 491-652 TTCAGGCTGACGTGTTTCAG GTGGGTGACCATAACCTTGG Rad1 RAD1 homolog NM_011232 190 290-479 GACCATCCATGCCTCTCCTA GCTTGCACACACTTTGCATT Rad17 RAD17 homolog NM_011233 233 712-944 CCAGGATGTGGAAAGACAAC AGATCGTCTCCAAGCATCTG Rad17 RAD17 homolog NM_011233 211 180-390 CATACCTGGGCTGTGTCCTT GGTGTTGGCCTCAAAGTCAT Rad17 RAD17 homolog NM_011233 215 1378-1592 AAATCGGATGCTGCCATATC AGTAAAGTGTCCCGGTCGTG Rad51 RAD51 homolog NM_011234 226 1113-1338 CCAGGCTGTACCTGAGAAAA ACATGAGCCTGTGAAGAAGC Rad51 RAD51 homolog NM_011234 212 825-1036 AGCTCCTTTACCAAGCGTCA TTGGGCTACTACCTGGTTGG Rad51 RAD51 homolog NM_011234 187 1712-1898 ATCCCTGCATGCTTGTTCTC CTGCAGCTGACCATAACGAA Raf1 v-raf-leukemia viral oncogene 1 NM_029780 209 604-812 GTTTTCTTGCCGAATAAGCA TCCACTTGCAGTTCTTCTCC Raf1 v-raf-leukemia viral oncogene 1 NM_029780 211 2663-2873 GACATGCAATTGGGAACTTG CCTGGAAGACAGATTCAGCA Raf1 v-raf-leukemia viral oncogene 1 NM_029780 178 1124-1301 CTACACCCCATGCCTTCACT GCTGAAGGTGAGGCTGATTC Raf1 v-raf-leukemia viral oncogene 1 NM_029780 216 2414-2629 AGAGTCAGCAGGCACCACTT GGCCACTTGCCCTACAAATA Ranbp17 RAN binding protein 17 NM_023146 228 2358-2585 AAAACAGGTCTCAGCGTTTG ACAACTTGAAGACGCCAAAG Ranbp17 RAN binding protein 17 NM_023146 221 2292-2512 TTGAACGGTGGTATGGAGAA GCCCTTGAGTTTCATTGGAT Ranbp17 RAN binding protein 17 NM_023146 186 40-225 TCAGAGTTTGGCTGAGTTGG AGACATGTTGCTGCAAGGAG Ranbp17 RAN binding protein 17 NM_023146 187 1496-1682 cgtcttgcatggctgatcta ggaaccagagaactgcaagc Ranbp17 RAN binding protein 17 NM_023146 183 1663-1845 gcttgcagttctctggttcc ggctcacatcttccccagta Ranbp17 RAN binding protein 17 NM_023146 112 4150-4261 gcttgtgacccatcaaacct tggccgcagtgtttattgta Raptor Raptor NM_028898 171 6760-6930 CCTTGCCAGATGAGAATGGT AAGATCTCCATGGCAACCAG Rasd1 RAS, dexamethasone-induced 1 NM_009026 183 286-468 AGGATGCTTACACCCCTACC ATGAGTCGCGGTTGTCTAAG Rb1 retinoblastoma 1 NM_009029 239 2251-2489 ATGTATGGCATCTGCAAGGT CGAGGAATGTGAGGTATTGG Rb1cc1 RB1-inducible coiled-coil 1 NM_009826 241 4937-5177 AGGTGGGAGATTTGGTTCTC AACTTTGTCCCCAAAGGAAC Rb1cc1 RB1-inducible coiled-coil 1 NM_009826 174 4096-4269 GTCAAGAACCACGAGCAAGA AAAGGCAGGAGTTTTGGCTA Rb1cc1 RB1-inducible coiled-coil 1 NM_009826 205 1859-2063 CACTGCTCCGCCTTGTAATA CCAAAGGATTCCCTTTTTGA Rbbp8 retinoblastoma binding protein 8 NM_001081223 153 1031-1183 AGAATCTGAACCCCAAGGTC TGAGGAGGTGTCTTTGAAGC Rbbp8 retinoblastoma binding protein 8 NM_001081223 160 639-798 CAACTGCAGCAGAAAATGGA TTTGTTCCACGTATCGGACA Rbbp8 retinoblastoma binding protein 8 NM_001081223 204 2455-2658 CCCAGGTACCAGATGAGGAA TACATGTGTGCCCAAGCAAT Rbl1 retinoblastoma-like 1 NM_011249 188 1804-1991 TCTGCAAACAGAGTCCCTTC GAAATCGGAGACAATGGTTG Rbl1 retinoblastoma-like 1 NM_011249 182 1047-1228 GGAGATTGGAACACCTCGAA AAGCTACAGGCGTGGTGACT Rbl1 retinoblastoma-like 1 NM_011249 231 2945-3175 TCCCACACATTAAGCAGCAG CAGGTGAGTCTGCATCTCCA Rbl2 retinoblastoma-like 2 NM_011250 182 2326-2507 CGAAAATGGAGGGATAACCT CAGGGGAAATCTGTTGAATG Rbl2 retinoblastoma-like 2 NM_011250 243 4156-4398 GAAAGCGTGCAATGTCTGAA TGCCACTACCACAAATGGAA Rbl2 retinoblastoma-like 2 NM_011250 192 1935-2126 AGGTCATGCCACCTCAAAAC TCTCGAATAGCCGCCTTCTA Rbpj recombination signal binding protein for immunoglobulin kappa J region NM_009035 203 1044-1246 CGACCCTGTATCACAACTCC CCATTCCCTCATAGAACGTG Rbpj recombination signal binding protein for immunoglobulin kappa J region NM_009035 197 1749-1945 TGAATGCAGCAAAAAGTTGA GTGAGAGGGACAGCTGAAAA Rbpj recombination signal binding protein for immunoglobulin kappa J region NM_009035 171 5020-5190 GTGGTTTTCTGTGCCACCTT CAGGACTGAACACGAGCAAA Rbpj recombination signal binding protein for immunoglobulin kappa J region NM_009035 201 3204-3404 gaagcagactcattgggcta gagccagaaagacaccagaa Rbpj recombination signal binding protein for immunoglobulin kappa J region NM_009035 235 4616-4850 cctgccaccatcttaacctt tggttggacacagaccagtt Reg1 regenerating islet-derived 1 NM_009042 249 88-336 ACTTCATCCTGCTCTCATGC CCTTAATCAGAGAGGCCACA Reg1 regenerating islet-derived 1 NM_009042 158 134-291 CCAGGAAGCTGAAGAAGACC CTGACACCAGGTAGCCTGAA Reg1 regenerating islet-derived 1 NM_009042 220 177-396 CCAGAAGGTTCCAATGCCTA GACGATTCCTTTTGGGATCA Reg3g regenerating islet-derived 3 gamma NM_011260 247 31-277 AGATGCTTCCCCGTATAACC CCACTGAGCACAGACACAAG Reg3g regenerating islet-derived 3 gamma NM_011260 216 95-310 TTCTCAGGTGCAAGGTGAAG TTGATCATGGAGGACAGGAA Reg3g regenerating islet-derived 3 gamma NM_011260 237 378-614 AACAGAGGTGGATGGGAGTG ATTTGGGATCTTGCTTGTGG Rel reticuloendotheliosis oncogene NM_009044 204 689-892 GCTGCTGGACATTGAAGACT ATTTCATCTCCTCCCCTGAC Rel reticuloendotheliosis oncogene NM_009044 186 1185-1370 AAACTGCTGCAAGATTGTGG GGACCCGCATGAAGAATAGT Rel reticuloendotheliosis oncogene NM_009044 109 1442-1550 AGTGACTCACCCCACCTCAC AGGCCCTTCTAGGAATGGAA Rela v-rel reticuloendotheliosis viral oncogene homolog A NM_009045 245 791-1035 GCGGGGACTATGACTTGAAT TCCCGTGAAATACACCTCAA Relb reticuloendotheliosis viral (v-rel) oncogene related B NM_009046 194 1774-1967 TGGTACTGCTAGCCTTGTGG AGGATGAGGAAGCTGGAAGA Ren1 renin 1 structural NM_031192 150 327-476 GTCATCTTTGACACGGGTTC TCCGTAGTGGATGGTGAAGT Ren1 renin 1 structural NM_031192 224 889-1112 TGGACACTGGTTCATCCTTT CAGTGTGCACAGCTTGTCTC Ren1 renin 1 structural NM_031192 223 644-866 TACCCCTGTCTTTGACCACA ACATAGCAGGGTGGAAGACC Ren1 renin 1 structural NM_031192 186 222-407 AGGCCTTCCTTGACCAATCT GTGAATCCCACAAGCAAGGT Ren1 renin 1 structural NM_031192 207 330-536 ATCTTTGACACGGGTTCAGC CACAGTGATTCCACCCACAG Ren1 renin 1 structural NM_031192 172 867-1038 GAAGAAGGCTGTGCGGTAGT CTCCCAGGTCAAAGGAAATG Ren1 renin 1 structural NM_031192 217 11-227 TAGAAAGCCTTGGCTGAACC AGGCCTCTTTGTGAATACGC Rgs19 regulator of G-protein signaling 19 NM_026446 175 762-936 TCTGAGGCCTAGGTCATTTG AAGGGTGTTGTTCTCCATGA Rgs19 regulator of G-protein signaling 19 NM_026446 193 1194-1386 GGCTGAAGAAAAGGATCACC CAACAGCTTTGCTCCCATAA Rgs19 regulator of G-protein signaling 19 NM_026446 229 441-669 TTCCTGCGCACAGAATACAG GCAGCTGTGCATCATCAAAT Rgs19 regulator of G-protein signaling 19 NM_026446 157 260-416 CTGTAGCTGCTCCTGGAACC GGGGCTATGCATCAACTTGT Rhoa ras homolog gene family, member A NM_016802 171 455-631 TTGTTGGTGATGGAGCTTGT GGCGGTCATAATCTTCCTGT Rictor rapamycin-insensitive companion of mTOR NM_030168 193 5780-5972 TCTGTCGCTTCAGGTTGTTG GCTTCCTTTGCTTTGTCCAG Ripk1 receptor (TNFRSF)-interacting serine-threonine kinase 1 NM_009068 175 2053-2227 CCAATGTTGCAGGATAGACC ATGACCCTGTGTGCTCAAAT Ripk2 receptor (TNFRSF)-interacting serine-threonine kinase 2 NM_138952 191 1278-1468 CTGGGATGGTATCGTTTCTG TAAGGCAGGCTTCAGTCATC Rn18s 18S RNA NR_003278 Rn18s 18S RNA NR_003278 298 1370-1667 ATTCCGATAACGAACGAGACT AGCTTATGACCCGCACTTACT Rn18s 18S RNA NR_003278 Rnf128 ring finger protein 128 NM_023270 249 519-767 GGTGCAAGTATCTTGGTTGG TCGATGACCATTGTGACTTG Rnf128 ring finger protein 128 NM_023270 231 2345-2575 GTTTACATTTGGCCTTGTGG AATTTGCACTGGGAACAAAA Rnf128 ring finger protein 128 NM_023270 158 758-915 TGGTCATCGAAGTAGGGAAA CTTCCTGCTTTGAGCTCTTG Rorc RAR-related orphan receptor gamma NM_011281 207 977-1183 CCAGCTACCAGAGGAAGTCA TGTGGTTGTTGGCATTGTAG Rorc RAR-related orphan receptor gamma NM_011281 214 1583-1796 CTGATGTTGAATCCCCTGAG CATCACTTGCTGCTGTTGTC Rorc RAR-related orphan receptor gamma NM_011281 200 608-807 GCCCACCATATTCCAATACC GTCTGGACCCTGTTCTGGTT Rpa3 replication protein A3 NM_026632 248 173-420 TTGAATTGATGGAGCCACTT CAGTGTAGCTTCCTGGCAAT Rpl37a ribosomal protein L37a NM_009084 152 35-186 GCTAAACGCACCAAGAAGGT ACGGCTCGTCTCTTCATCTT Rpl37a ribosomal protein L37a NM_009084 210 113-322 AAAATTGAAATCAGCCAGCA ACAGCAGGGCTTCTACTGGT Rps3 ribosomal protein S3 NM_012052 202 1432-1633 CCTGGAACCCACTCTGTATG TGACAGCTTCACTCTCACCA Rps3 ribosomal protein S3 NM_012052 173 96-268 TGCAGATTTCCAAGAAGAGG CCCAAGAACATTCTGTGTCC Rps3 ribosomal protein S3 NM_012052 179 1253-1431 GCCCTGCAGGAGAGAGTATG ACAGCCAGGGCTACAGAGAA Rps3 ribosomal protein S3 NM_012052 206 492-697 AGGTTGTGGTGTCTGGGAAG AGGCTTCTTGGGACCAATCT Rps3 ribosomal protein S3 NM_012052 185 327-511 CTGAAGGCAGCGTAGAGCTT CTTCCCAGACACCACAACCT Rxrb retinoid X receptor beta NM_011306 196 1658-1853 CATTGACACCTTCCTCATGG ACTTGGAGACCAAACGAACC Rxrb retinoid X receptor beta NM_011306 250 1038-1287 GTGGAGCAGAAGAGTGACCA CATCTCGGACATCAATGGAC Rxrb retinoid X receptor beta NM_011306 221 1318-1538 ACAGAAACTCAGCCCATTCC CTGCTTGCAATAGGTCTCCA S100a3 S100 calcium binding protein A3 NM_011310 242 45-286 AGCAGCAGTGTGAGGATGAC ACGTACTCCCCAAAGTCCAC S100a3 S100 calcium binding protein A3 NM_011310 235 293-527 ACTTGCCAGCCTCTGTCTCT TGGGGTTAGCACATCAAGAA S100a4 S100 calcium binding protein A4 NM_011311 176 120-295 AGGGTGACAAGTTCAAGCTG GCAGGACAGGAAGACACAGT S1pr1 sphingosine-1-phosphate receptor 1 NM_007901 210 1296-1505 GAGTGTCTTCATTGCCTGCT GGGCATTTGCAACAAGATAC S1pr1 sphingosine-1-phosphate receptor 1 NM_007901 233 669-901 TCTCATCTGCTGCTTCATCA ATGCAGAGAGAGCCACAAAC S1pr1 sphingosine-1-phosphate receptor 1 NM_007901 159 1136-1294 TCTTCACTCTGCTCCTGCTT GGACAATGATCACCGTCTTC S1pr2 sphingosine-1-phosphate receptor 2 NM_010333 210 510-719 CTCTCAGGGCATGTCACTCT AATCAGCGATATCAGCCAAG S1pr2 sphingosine-1-phosphate receptor 2 NM_010333 211 650-860 GCTCTACGGCAGTGACAAAA CAGAGCCACGATAGCCAGTA S1pr2 sphingosine-1-phosphate receptor 2 NM_010333 215 1063-1277 TTGCCACCCTTAACTCACTG CTCCAGAAATGTCGGTGATG S1pr3 sphingosine-1-phosphate receptor 3 NM_010101 154 512-665 ATTGCCATCTGGAAAAACAA GGAACCACACTGTTGGAGAC S1pr3 sphingosine-1-phosphate receptor 3 NM_010101 181 1320-1500 TCGACCCAAGCAGAAGTAAG AAATAGGTGTGGCTGCAGAG S1pr3 sphingosine-1-phosphate receptor 3 NM_010101 230 866-1095 GAGAACTTTCCCGACTGCTC GACCAACAGGCAATGAACAC Sall2 sal-like 2 NM_015772 180 3779-3958 CTCTTCTCCCTTTCCCTTTG ACCTACCACCCCTTACAAGC Sall2 sal-like 2 NM_015772 181 4563-4743 TCGATGTTCAGCTCTTGTGA GGGTTTTGAGAAGACAGCAA Sall2 sal-like 2 NM_015772 161 2803-2963 GAGGAGGAAGACGTGACAGA TCCATCTCCTTCACAGTGGT Sall2 sal-like 2 NM_015772 240 467-706 CTCCCTCTCTTACCGCTCAC TCTCCTGGCCTCCAATTATC Sall2 sal-like 2 NM_015772 184 4338-4521 TGCCAGGACTACTCCAGCTT CAGCAATGCCTGTTTTAGCA Sall2 sal-like 2 NM_015772 157 3045-3201 GCAGGGAACCAGTGATGTTT TCCTGGATCCTTCTTCATGG Sall2 sal-like 2 NM_015772 213 1016-1228 GTGGCCACTTGAACATTCCT TGGGACTGAAGAGAGGCAGT Sall2 sal-like 2 NM_015772 247 686-932 TGATAATTGGAGGCCAGGAG TTGGGACTGGCCAAGATAAG Sc5d sterol-C5-desaturase homolog NM_172769 225 897-1121 TGAAGGGAAAGGACCACATA ACACTCAAGCAATGCTGACA Sc5d sterol-C5-desaturase homolog NM_172769 164 117-280 GATGGACCTGGTTCTCAGTG AATAGCTGAGGGTTGCACAG Sc5d sterol-C5-desaturase homolog NM_172769 203 614-816 ATGCTTTTCACCCTGTGGAC GTGGTGGTCTGTGTGGTGAG Sc5d sterol-C5-desaturase homolog NM_172769 246 388-633 ACCGTCTCACTGTTCCTGCT GTCCACAGGGTGAAAAGCAT Scarb1 scavenger receptor class B, member 1 NM_016741 155 652-806 AGCCTGAAGCTGATGATGAC AATTTGCCCTTTATGGGAAG Scn3b sodium channel, voltage-gated, type III, beta NM_178227 239 773-1011 AATGTGTCCAGGGAGTTTGA GCAAGGTAGTCAGACGCATT Scn3b sodium channel, voltage-gated, type III, beta NM_178227 226 1118-1343 GCATTTGGCATCTACAATGG TCCAAACACATACGGAGGAA Scn3b sodium channel, voltage-gated, type III, beta NM_178227 189 1562-1750 GCCTGAACTGAAGAGCCAAC TTCATCCTTTTGCTGCAGTG Scn3b sodium channel, voltage-gated, type III, beta NM_001083917 162 1831-1992 GACCTTGCCTGAACTGAAGA TTGCAGACAGGACACAGAGA Scn3b sodium channel, voltage-gated, type III, beta NM_001083917 239 1138-1376 AATGTGTCCAGGGAGTTTGA GCAAGGTAGTCAGACGCATT Scn3b sodium channel, voltage-gated, type III, beta NM_001083917 212 3545-3756 CCCAGTCCCTAAGTGGAAAT GCCCACTGCTATCTTTCTCA Scnn1g sodium channel, nonvoltage-gated 1 gamma NM_011326 200 2302-2501 GGGTCCTGAAAGAGAATGGT TGTCCCAGTGTCAATGACTG Scnn1g sodium channel, nonvoltage-gated 1 gamma NM_011326 173 1122-1294 CGAGATCGAGACAGCAATGT TCTTCGTTTGGAAGCATGAG Scnn1g sodium channel, nonvoltage-gated 1 gamma NM_011326 193 1819-2011 ACACCACCCTCCACTGAGAC CTGTGAGCTGGGAGGAAAAG Scye1 Small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating) NM_007926 226 364-589 TCCACTGCAGACGAACTGTA ACAACCAATTCGAAGATCCA SDHA succinate dehydrogenase complex, subunit A NM_023281 192 1079-1270 TGAGATCCGTGAAGGAAGAG ATCCCACCCATGTTGTAATG SDHA succinate dehydrogenase complex, subunit A NM_023281 155 1253-1407 TTACAACATGGGTGGGATTC CCAAGAGAGAATTTGCTCCA SDHA succinate dehydrogenase complex, subunit A NM_023281 179 1846-2024 ATTACTCCAAGCCCATCCAG GTAGGAGCGGATAGCAGGAG Sec16A SEC16 homolog A NM_153125 223 3330-3552 CTCTTCCCAATCATCCCAGA GCCAAGCTTTCAGACTGTCC Sec16B SEC16 homolog B NM_033354 208 729-936 TGCTTCTGTGTCTGGACAGG CTGAATAGGCCTCCAAGCTG Sec23A SEC23A NM_009147 248 2067-2314 TACGCCTACTCCTTCAGTGG ATGTATCTCGGCATTGGAAA Sec23B SEC23B NM_019787 197 2229-2425 GCTCGGTTCCTGTTGTCTAA TCTGACAGCATTGTCTTCCA Sec24A Sec24 related gene family, member A NM_175255 243 3054-3296 TTTCCTTCCAGTCAGCACTC CTGAAGAGCGGTAAGCTGAG Sec24A Sec24 related gene family, member A NM_175255 151 3285-3435 ACCGCTCTTCAGTCCTGAGT CACATGGCAAAAATTCGTTC Sec24A Sec24 related gene family, member A NM_175255 216 1000-1215 TCAGAACCCAGCTGCTACAC TTGAAGCTGGTTTGAAGTGC Sec24A Sec24 related gene family, member A NM_175255 232 1234-1465 TCCCTTACAGAACCCACCTC GCCACCTCCTTCAATCTCAT Sec24b Sec24 related gene family, member B NM_207209 246 3740-3985 TGGATACCCTGACTTTGCAT ACCTGCTGTTGGATGTGAAT Sec24c Sec24 related gene family, member C NM_172596 195 1059-1253 CCCAGCCCTATTCAGGTTAT AGCCTGTTTAGCCATGTCAG Sec24d Sec24 related gene family, member D NM_027135 216 1245-1460 TGCAGCTGTGTGAATGAAGT CTTGACGAGGCCATTCTTTA Sec24d Sec24 related gene family, member D NM_027135 193 1334-1526 GTCGCTGGGATCCTATGAAT AGACGTCTCCTCATGCTCCT Sec24d Sec24 related gene family, member D NM_027135 206 876-1081 CCCAGCCCTATTCAAGTGAT AGTGGGATCTGAGCTTGCTT Sec24d Sec24 related gene family, member D NM_027135 167 1853-2019 GGGGAAGCTCAAGAACAGAG AAGCCACATCCACAAACTGA Sell selectin, lymphocyte NM_011346 167 607-773 CGTGGAGAATGTGTGGAAAC CACTTGGACTGGAAGCTGAA Sell selectin, lymphocyte NM_011346 234 1342-1575 TTGCTCAACGAATCTGGAAG TTTGGCATTAGCTTCTGTGC Sell selectin, lymphocyte NM_011346 298 1842-2139 GGGAAAATCTCCTGCATTGA CAGGTTGGGCAAGTTAAGGA Sell selectin, lymphocyte NM_011346 280 171-450 CTGGACACTGCTCTGTTGTG ACCCCAGTTCTCTGCTTCTT Sell selectin, lymphocyte NM_011346 171 1090-1260 GGTGACTACAACCCCCTCTT TTAGCACTTCATGGCTTTCC Sell selectin, lymphocyte NM_011346 121 144-264 CTCGAGGAACATCCTGAAGC AGCATTTTCCCAGTTCATGG Selp selectin, platelet NM_011347 191 1244-1434 GCAGCTTTTCCTGTGATGAA CTGGCATGTGGATTTGTAGG Serpinb2 serine (or cysteine) peptidase inhibitor, clade B, member 2 NM_011111 192 288-479 GGCACAAGCAGGAGATAAAA TCAAGGAAGTCCACTGCTTC Serpinb2 serine (or cysteine) peptidase inhibitor, clade B, member 2 NM_011111 219 347-565 CACCACAGGGGGATTATTTG AACCTTCGGGTAGCAGGTTT Serpinb2 serine (or cysteine) peptidase inhibitor, clade B, member 2 NM_011111 247 582-828 CAAGATGGTGCTGGTGAATG GGATGCGTCCTCAATCTCAT Serpinb2 serine (or cysteine) peptidase inhibitor, clade B, member 2 NM_011111 248 697-944 CAGATGATGTTCCTCCATGC GCCAGTTTGAACTTGGGAAT Serpine1 serine (or cysteine) peptidase inhibitor, clade E, member 1 NM_008871 209 132-342 ATGCAGATGTCTTCAGCCCT CTGCAGCATAGCCAGCACCG Serpine1 serine (or cysteine) peptidase inhibitor, clade E, member 1 NM_008871 TCCAAGATGCTATGGGATTC TTCTCAGAGGTGGAAAGAGC Serpine1 serine (or cysteine) peptidase inhibitor, clade E, member 1 NM_008871 Sertad1 SERTA domain containing 1 NM_018820 231 848-1078 GACCCAGGGAGAATTGACTT GCCCAAACACCATTACTGTC Sfmbt2 Scm-like with four mbt domains 2 NM_177386 247 3553-3799 TCTGTCAGAGGTGCCTTTTC AAAACGACTTCCCCAAAATC Sfmbt2 Scm-like with four mbt domains 2 NM_177386 236 3384-3619 ACCTGTCCATCTTGCTACCC GGCTTTGCTTACCCAGTAGC Sfmbt2 Scm-like with four mbt domains 2 NM_177386 237 2244-2480 GAAGGAAACGACGGAAATCA TTTTCTGTGCTGAGCCCTTT Sh3glb1 SH3-domain GRB2-like B1 NM_019464 157 922-1078 AGTACACACGCCCATCATCT GTGTCCCAGAGGTCTGATTG Sh3glb2 SH3-domain GRB2-like endophilin B2 NM_139302 219 956-1174 GGTACCTACTGGGGCTGTCT TTCTTGTTGCCTCTCTCACC Sh3glb2 SH3-domain GRB2-like endophilin B2 NM_139302 219 1472-1690 GCTCTTGGCATGAAAGAACA CAGACAGGCAGAGGTCAGAA Sh3glb2 SH3-domain GRB2-like endophilin B2 NM_139302 199 481-679 GGAAAACGATTTCGAAGGAG TCAGCCTTGTCGACTTCATC Sh3glb2 SH3-domain GRB2-like endophilin B2 NM_139302 208 1300-1507 GTGCCCGTCATTCAGCTATT ACAGCCAGAAGGCAGATGTT Shh sonic hedgehog NM_009170 205 307-511 cagctcacaagtcctcaggt cctagggtcttctcggctac Shh sonic hedgehog NM_009170 223 1966-2188 acggaccttcaagagcctta cccatggagcaggttttagt Shh sonic hedgehog NM_009170 248 2132-2379 cctctcctgctatgctcctg gtggcggttacaaagcaaat Skp2 S-phase kinase-associated protein 2 NM_013787 214 1821-2034 ACTCTTCCAAGTGCCCTTCT ATCCCAGAAAAGACCACCTC Skp2 S-phase kinase-associated protein 2 NM_013787 234 183-416 GCGCTAAAACAGGAGTCTGG TGGGATGTTCTCACTGTCCA Skp2 S-phase kinase-associated protein 2 NM_013787 181 1561-1741 CTCTGGAACGAGGAAAGCAG CTTAGGGCACAGCACTGACA Skp2 S-phase kinase-associated protein 2 NM_013787 178 1462-1639 tggacagcaagaagaacctg aggctaaggcaaagccaata Skp2 S-phase kinase-associated protein 2 NM_013787 250 262-511 tgcataggaagcaccttcag cgacggatgatcacaaagtc Slc25a30 solute carrier family 25, member 30 NM_026232 226 1235-1460 GCATAGGAACACCCACTCAC GGTAGGGGGATAACAGTGCT Slc25a30 solute carrier family 25, member 30 NM_026232 232 629-860 TGAGCATTTACCAGCAGGAG CGGGTTCTCACAACATCAAC Slc2a1 solute carrier family 2 (facilitated glucose transporter), member 1 NM_011400 163 2055-2217 TGCCAAGCTAATCTGTAGGG GAATGGGCGAATCCTAAAAT Slc2a1 solute carrier family 2 (facilitated glucose transporter), member 1 NM_011400 167 590-756 TCATCATCGGTGTGTACTGC ATTGCCCATGATGGAGTCTA Slc2a1 solute carrier family 2 (facilitated glucose transporter), member 1 NM_011400 196 316-511 CCCCAGAAGGTTATTGAGGA GGTTCATCATCAGCATGGAG Slc2a2 solute carrier family 2, member 2 NM_031197 212 755-966 AGGATCATTGGCACATCCTA AGTCGATGCCTCTTCCTTTT Slc2a2 solute carrier family 2, member 2 NM_031197 202 1097-1298 TTTTTCAGACAGCTGGCATC ATCCAGGCGAATTTATCCAG Slc2a2 solute carrier family 2, member 2 NM_031197 224 122-345 AAGACAAGATCACCGGAACC TGGTGTTGTGTATGCTGGTG Slc6a6 solute carrier family 6, member 6 NM_009320 165 5122-5286 ACAGGAAGGGGCTTTCTCTA CCTTCTCTAAGGTGCCTTCC Slc6a6 solute carrier family 6, member 6 NM_009320 235 2678-2912 TTCAGGAGGAAGAACACAGC CCAGTCCCACTGACTACCAC Slc6a6 solute carrier family 6, member 6 NM_009320 151 3873-4023 AACCACTGTGGGTGACTGAA TGCCAACCCAAAATACTGAA Slitrk1 SLIT and NTRK-like family, member 1 NM_199065 212 3243-3454 AAGAGCAGACTGTGGACCTG GCTATCCACAGGGGAAAAAT Smc1a structural maintenance of chromosomes 1A NM_019710 192 3145-3336 AGAGTGTGCTTCAGCGGATT CCACAGATTCAAAGCAAGCA Smc1a structural maintenance of chromosomes 1A NM_019710 233 1327-1559 ATCTGGAAGAGCGGAAGAAA CCCTAATTGCTCCATCACCT Smc1a structural maintenance of chromosomes 1A NM_019710 171 478-648 GCATTCTCATCAAAGCTCGT TGTCTTCTTCAGCCTTCACC Snx30 sorting nexin family member 30 NM_172468 192 4581-4772 CAAAGGCAAAAGAGGTTTGA TTCCGAGAGCATAAAACTGG Socs1 suppressor of cytokine signaling 1 NM_009896 295 TCCCTCTTAACCCGGTACTC CCAGACACAAGCTGCTACAA Socs1 suppressor of cytokine signaling 1 NM_009896 195 GAGACCTCATCCCACCTCTC GCACAGCAGAAAAATGAAGC Socs1 suppressor of cytokine signaling 1 NM_009896 159 AGACCTTCGACTGCCTTTTC ACGGAGTACCGGGTTAAGAG Socs1 suppressor of cytokine signaling 1 NM_009896 277 CTCCGTGACTACCTGAGTTCC CAGACACAAGCTGCTACAACC Socs1 suppressor of cytokine signaling 1 NM_009896 205 752-956 CGGTACTCCGTGACTACCTGA ATGAGGTCTCCAGCCAGAAGT Socs1 suppressor of cytokine signaling 1 NM_009896 277 GGGCGCCTTATTATTTCTTAT CCTGGTTTGTGCAAAGATACT Socs2 suppressor of cytokine signaling 2 NM_007706 118 1156-1273 TTAAGGACAGTTGGGCTCAG GATCTTGAGCAGCCATAGGA Socs2 suppressor of cytokine signaling 2 NM_007706 120 712-831 CGGATTGAGTACCAAGATGG ATCCTTGCACATCTGGACAT Socs2 suppressor of cytokine signaling 2 NM_007706 280 871-1150 CACCTGTACCTGACCAAACC AATTCTGCGCAGTTATCCAG Socs2 suppressor of cytokine signaling 2 NM_007706 124 1395-1518 ATGCACTGGGTCAAAAGTCC CCAGGCGTCTAGAAGTGGAG Socs2 suppressor of cytokine signaling 2 NM_007706 145 963-1107 GGGACTGCCTTTACCAACAA CACATAGCTGCATTCGGAGA Socs2 suppressor of cytokine signaling 2 NM_007706 226 406-631 GGACGTGTTGACTCATCTCC TTCCTTCTGGAGCCTCTTTT Spdya speedy homolog A XM_001480221 183 672-854 TTACATCTGGCAACGAGAGC CCTGTGTCACTGGAGGAAGA Spdya speedy homolog A XM_001480221 195 351-845 TTTCTTGTGGATGGACTGCT CCTAAAGCCCATGGAAAAAT Spdya speedy homolog A AY820306 205 489-693 GGACCAACTCTGGGACAGAA ACCACACAGTGAGCAATCCA Spdya speedy homolog A AY820306 161 650-810 CCAGGGGACCTAGTGCTACA CGTGTCCACTGAGAATGCAC Spdya speedy homolog A AY820306 157 436-592 TGGGCTTTAGGGAAAAACTG GCTCTCGTTGCCAGATGTAA Sphk1 sphingosine kinase 1 NM_011451 190 286-475 CTGGTGTGTGCAGAGGAGTT ACCCAGCATAGTGGTTCACA Sphk1 sphingosine kinase 1 NM_011451 160 661-820 GGGGAGATTCGTTTCACAGT CCAGAGGAACAAGGTGTGTG Sphk1 sphingosine kinase 1 NM_011451 200 221-420 TCCTGGAGGAGGCAGAGATA GCTACACAGGGGTTTCTGGA Sphk1 sphingosine kinase 1 NM_011451 202 830-1031 tgccttctcattggactgtg atatgcttgcccttctgcat Sphk1 sphingosine kinase 1 NM_011451 154 494-647 aagacctgctcatcaactgc ttctcactctcgaggtccac Spink3 serine peptidase inhibitor, Kazal type 3 NM_009258 205 180-384 CTAGTTGCCATGATGCAGTG AACCCACTTGCCAAACATTA Spink3 serine peptidase inhibitor, Kazal type 3 NM_009258 169 73-241 ACCCAGATCTTCGACAATGA GTCAGTCCCACACACAGGAT Spink3 serine peptidase inhibitor, Kazal type 3 NM_009258 215 87-301 CAATGAAGGTGGCTGTCATC AGGCTCTATGCGTTTCCTGT Spon2 spondin 2, extracellular matrix protein NM_133903 194 1915-2108 CTCCTCCCATCCCAGTAGAT CATCTGACTCTGGACCCATC Spon2 spondin 2, extracellular matrix protein NM_133903 156 1105-1260 GAGGACCATGTGGAAAGTTG AAGAGCTGCTTGCTACTGGA Spon2 spondin 2, extracellular matrix protein NM_133903 204 1064-1267 GGACTGTGAGGTTTCCCTGT GGATCCTAAGAGCTGCTTGC Spp1 secreted phosphoprotein 1 NM_009263 TGAGTCAAGTCAGCTGGATG TTCCAGGCTGGCTTTGGAAC Spp1 secreted phosphoprotein 1 NM_009263 197 358-556 GACCCATCTCAGAAGCAGAA TTCGTCAGATTCATCCGAGT Spp1 secreted phosphoprotein 1 NM_009263 Spry4 sprouty homolog 4 NM_011898 151 3391-3541 GAATTCTTCCTCCCCACAGA CTGTGTTTGCATCCCCTATG Spry4 sprouty homolog 4 NM_011898 206 2472-2677 GTGGTATTTTGTCCCCATCC GGGGTGAATCCTTGAGAAAA Sqstm1 sequestosome 1 NM_011018 174 1176-1349 AGCTGCCCTATACCCACATC GGGTGCTTCGAATACTGGAT Srebf2 sterol regulatory element binding factor 2 NM_033218 224 3368-3591 CCATCTTCCCCTCTCTTTCC AGGGAAGATCCTGGGAGAAA Srebf2 sterol regulatory element binding factor 2 NM_033218 204 3683-3886 CCAAGGCTTTTGGATCATTT AACCAGAGGCAGAAAGGAGA Srebf2 sterol regulatory element binding factor 2 NM_033218 231 1623-1853 AACACTGACCAGCACCCATA GTCTAGGTCTGCCTGCTTCC Srebf2 sterol regulatory element binding factor 2 NM_033218 155 2952-3106 CACCTGTGGAGCAGTCTCAA TGGTAGGTCTCACCCAGGAG Stat1 signal transducer and activator of transcription 1 NM_009283 235 4894-5128 ACTGTGGAATGAAGGCATGT AGAATAGTGCCTGGTGCAAG Stat1 signal transducer and activator of transcription 1 NM_009283 155 1394-1548 GGTGAAATTGCAAGAGCTGA GACTTCCGTTGGTGGATTCT Stat1 signal transducer and activator of transcription 1 NM_009283 208 3607-3814 CTCAGAAATCCGCCTGTCTC ACACACGTGCCACAAAACAT Stat1 signal transducer and activator of transcription 1 NM_009283 155 1568-1722 CCTGCAACTGAAGGAACAGA TCACCACGACAGGAAGAGAG Stat1 signal transducer and activator of transcription 1 NM_009283 241 1271-1511 CCTCTTCCAGCAGCTCATTC TGTGTGCGTACCCAAGATGT Stat1 signal transducer and activator of transcription 1 NM_009283 187 3795-3981 ATGTTTTGTGGCACGTGTGT TGTGCACACTTACCGTGGTT Stat3 signal transducer and activator of transcription 3 NM_213659 187 3650-3836 ATCTGTAACCACAGGGCAAA GTAAGCTGAGTGAGCGAAGC Stat3 signal transducer and activator of transcription 3 NM_213659 157 2589-2745 GTGAGGAGCTGAAACCAGAA GATTGCCCAAAGATAGCAGA Stat3 signal transducer and activator of transcription 3 NM_213659 165 1060-1224 GACCGTCTGGAAAACTGGAT GTTTCTGAACAGCTCCACGA Stk4 serine/threonine kinase 4 NM_021420 159 138-296 AAGCTTGGAGAGGGGTCTTA CTTGACTACGTGAGGGCTGT Stox2 storkhead box 2 NM_001114311 250 6320-6569 TCTGACCCTCTGAACGTAGC TAAAGCCCATCTTGCTATGC Stox2 storkhead box 2 NM_001114311 247 8640-8886 AGCCCTGCTTTGTAGGATCT CTCGCTCACAGGACGTTATT Strad RIKEN cDNA 2610019A05 gene NM_028126 239 1651-1889 TCTTCCCAACACTTGCTCTC ATGGATTCTTGGGAAAGGAG Strad RIKEN cDNA 2610019A05 gene NM_028126 178 1134-1311 TGCTGAACCACTCCTTCTTC CAGAACTCCCAGTCATCCAC Strad RIKEN cDNA 2610019A05 gene NM_028126 207 470-676 TACGGCTCTGCAAAGGATCT CATGCTAAGGTTGCTGCGTA Strad RIKEN cDNA 2610019A05 gene NM_028126 196 647-842 CTGTCTGGTTTACGCAGCAA GGCCATTGGCTAGTTCACAT Strad RIKEN cDNA 2610019A05 gene NM_028126 248 61-308 CTGCGCTCTGACTCCTAGAC TCACATACTCTCCCGTTGGT Sumo1 SMT3 suppressor of mif two 3 homolog 1 NM_009460 222 896-1117 TTTTAAAATCTGCGGGTCTG AGCAGTGTCTGTTGCGTACA Sumo1 SMT3 suppressor of mif two 3 homolog 1 NM_009460 201 803-1003 TGCTTCACTCCTGGACTGTG TCTCTCCAGTGAAGCCACCT Sumo1 SMT3 suppressor of mif two 3 homolog 1 NM_009460 168 982-1149 AAAGGTGGCTTCACTGGAGA GTCCCAGGCCAAAAAGTACA Sumo1 SMT3 suppressor of mif two 3 homolog 1 NM_009460 201 623-823 tttggtgatcagacctcagc tcacagtccaggagtgaagc Sumo1 SMT3 suppressor of mif two 3 homolog 1 NM_009460 175 4-178 agtgacgcaagacgtagagg tcctcagttgaaggttttgc Sumo2 SMT3 suppressor of mif two 3 homolog 2 NM_133354 169 189-357 ATGGTTCTGTGGTGCAGTTT TCTTCATCCTCCATTTCCAA Sumo2 SMT3 suppressor of mif two 3 homolog 2 NM_133354 184 305-488 CAGCCAATCAACGAAACAGA ATGTGGTGGGACCAAATTGT Sumo2 SMT3 suppressor of mif two 3 homolog 2 NM_133354 177 621-797 CCGATGTTCTGTTCTGGTTG GCAAGGATTTGGTGTTGTTG Supt16h suppressor of Ty 16 homolog NM_033618 150 2460-2609 ACAAAGGAGGAGCTGGAGTT CACTTCATCCAGTGTCACCA Supt16h suppressor of Ty 16 homolog NM_033618 219 1255-1473 AAGAAGGGAAAAAGCCAGAA CAGTAAGTAATGCCGCCCTA Supt16h suppressor of Ty 16 homolog NM_033618 172 589-760 TTGTGGCATACACCATTGCT GCCTTTTCCACAGACTCAGC Supt4h1 suppressor of Ty 4 homolog 1 NM_009296 290 GCTGAAAAGTCGAGGAGTGG AACACAGGTGGGAAATCAGC Supt4h1 suppressor of Ty 4 homolog 1 NM_009296 208 GTGTTGTCGTATCGGTGAGG ATCGCAATGATTCCATCAAA Supt4h1 suppressor of Ty 4 homolog 1 NM_009296 199 TGAAGGGCAACAGAGAGATG TAGGCCACTCCTCGACTTTT Supt4h2 suppressor of Ty 4 homolog 2 NM_011509 195 GAAGGGCAACAGAGAGATGG GCCACTCCTCGACTTTTCAG Supt4h2 suppressor of Ty 4 homolog 2 NM_011509 136 TGATGAGTCCAGAGGACAGC TAGGCCACTCCTCGACTTTT Supt4h2 suppressor of Ty 4 homolog 2 NM_011509 157 TTTGCTGTGCTCGTTAGTCA GTCCTCTGGACTCATCATCG Supt5h suppressor of Ty 5 homolog NM_013676 160 CACCAAGTCCAGCAGGCTAT GGTGTGTGGGGATTGTAACC Supt5h suppressor of Ty 5 homolog NM_013676 196 TTGCCATGTCTGCTGTGATT AGGACCTTGCCCTGTAGGTT Supt5h suppressor of Ty 5 homolog NM_013676 191 CATGGGGGCTTCATTTTAGA TCTTCTCTCTGGTCCCTCCA Syk spleen tyrosine kinase NM_011518 199 585-783 GGAGAACCTCATCAGGGAAT TCCATTGGTCTTTGACCCTA Syk spleen tyrosine kinase NM_011518 194 2775-2968 CCTTGTTGCTGCCACTAAAA CCCCACTTCCTGTTCATTCT Syk spleen tyrosine kinase NM_011518 152 4744-4895 ACCTATGACCCTTGGTCAGC CGCACACAGAGACAGGTTTT Syk spleen tyrosine kinase NM_011518 186 4151-4336 TGGGTCAGACCACCTGTAGA GAGGCCTCCACAGACTTCTC Syt17 synaptotagmin XVII NM_138649 167 1293-1459 CGGACTCAAGCTTGTGAAAA CGATGAAGTCATTGCTGCTT Syt17 synaptotagmin XVII NM_138649 201 869-1069 ACTCCAACCCCTACGTCAAG CTTTCCCAATCACACAGTGG Syt9 synaptotagmin IX NM_021889 224 2624-2847 GCTCTTTTCCACCTCAGACA TAGGTAATAGCCCCCAGTCC Syt9 synaptotagmin IX NM_021889 166 1947-2112 GGAAGAGAGCAAGTGGCATA CTGCCTATTTAGCACCTGGA Syt9 synaptotagmin IX NM_021889 229 2225-2453 TAAGCCAGCCTGGAAAAAGT ATATTCCACTGGGAGGCAAG Syt9 synaptotagmin IX NM_021889 206 1661-1866 actggcactctctgatggag aacccttcagattcaccaca Syt9 synaptotagmin IX NM_021889 213 852-1064 gcggaggagtaacagcaaag acagggttcagggtcttcct Syt9 synaptotagmin IX NM_021889 237 1440-1676 caccaagaggaacacgctta atcagagagtgccagtgtgc Tacc2 transforming, acidic coiled-coil containing protein 2 NM_206856 155 1896-2050 GAAGTCTCCAAAGCGGTCTC CCGTCATACACGTCCACTTC Tacc2 transforming, acidic coiled-coil containing protein 2 NM_206856 232 1054-1285 GTCCCCAGTGAGGAACACTT AGGCTGTGGTAAGAGGCACT Tank TRAF family member-associated Nf-kappa B activator NM_011529 222 287-508 ACAAAGAATACGCGAGCAAC CGTCTCACCTTTGATTGCTT Tbk1 TANK-binding kinase 1 NM_019786 197 990-1186 GGGGTTTTGACCAGTTCTTT GCGTCGTCCTTCGTAGATAA Tbx21 T-box 21 NM_019507 244 926-1169 CCTGCAGTCTCTCCACAAGT GGGGACACTCGTATCAACAG Tbx21 T-box 21 NM_019507 233 685-917 CCACAAGCCATTACAGGATG CTGGGTCACATTGTTGGAAG Tbx21 T-box 21 NM_019507 198 1760-1957 ATTGGAAGGTGCCCACTAAC TGACTGTAGTTCGGGCAGAG Tbx21 T-box 21 NM_019507 252 1082-1333 TCAGCTGAAAATCGACAACA TAACTGTGTTCCCGAGGTGT Tbx21 T-box 21 NM_019507 121 545-665 GGTGTCTGGGAAGCTGAGAG GAAGGACAGGAATGGGAACA Tbx21 T-box 21 NM_019507 214 1986-2199 GTTCCATGGAGAACGGAGAA CTGTTTGGCTGGCTGTTGTA Tbx21 T-box 21 NM_019507 152 792-943 CCAGGGAACCGCTTATATGT TTGTGGAGAGACTGCAGGAC Tbx21 T-box 21 NM_019507 173 1607-1779 AGGACTAGGCGAAGGAGACA GTTAGTGGGCACCTTCCAAT Tbx21 T-box 21 NM_019507 173 545-717 GGTGTCTGGGAAGCTGAGAG CCACATCCACAAACATCCTG Tcea1 transcription elongation factor A (SII) 1 BC006022 193 TCCTTGGATCTCTTGCATCTG ACCTGTGGTGGGCTTTATGA Tcea1 transcription elongation factor A (SII) 1 BC006022 102 TTCATAAAGCCCACCACAGG GCTGCCTCCAGGAACTCTAC Tcea1 transcription elongation factor A (SII) 1 BC006022 243 TCCCATGACCCTAGAATTGC CTGCTTACATTGCTGCTGGA Tcfap2a transcription factor AP-2, alpha NM_011547 173 1846-2018 CTTCCCTTGCGTACTTCAGA GAAGTTCAAGTGGGTGGTTG Tcfap2a transcription factor AP-2, alpha NM_011547 234 558-791 ACTCCTTACCTCACGCCATC TGTACTTCGAGGTGGAGCTG Tcfap2a transcription factor AP-2, alpha NM_011547 234 1093-1326 CAATGAGCAAGTGGCAAGAA AGGGCCTCGGTGAGATAGTT Tcn2 transcobalamin 2 NM_015749 199 1255-1453 TCTTTGCTGGATCTTCCTTG TGGGGTTTGTAGTCAGCAAT Tcn2 transcobalamin 2 NM_015749 193 587-779 ACAGCTCAAGTGGTTCTTGG GTGGCCCTGGTAGGTAAAGT Tcn2 transcobalamin 2 NM_015749 189 1504-1692 CCTCCTGATGTCTTCACACC ATGAAAGACCTGTGGGATCA Tek endothelial-specific receptor tyrosine kinase NM_013690 228 3074-3301 CTTCCTGCGTAAGAGCAGAG CCTCGTGACAATCCAAAATC Tek endothelial-specific receptor tyrosine kinase NM_013690 241 3906-4146 TGCTCGGAGTAAGAATGTGC TTCTTCCTGTGCTGTCAAGG Tek endothelial-specific receptor tyrosine kinase NM_013690 172 811-982 AAAATGGCTCCTTCATCCAC TGAGCTTCACATCTCCGAAC Tek endothelial-specific receptor tyrosine kinase NM_013690 216 2229-2444 GCCTGGACCCTTAGTGACAT TAGGCCCTTGAGCTGGTACT Tek endothelial-specific receptor tyrosine kinase NM_013690 228 3074-3301 CTTCCTGCGTAAGAGCAGAG CCTCGTGACAATCCAAAATC Tek endothelial-specific receptor tyrosine kinase NM_013690 121 2281-2401 CCAACATCACTGACTCCACA TTCACATCAATGTGCTGGTC Tek endothelial-specific receptor tyrosine kinase NM_013690 241 3906-4146 TGCTCGGAGTAAGAATGTGC TTCTTCCTGTGCTGTCAAGG Tek endothelial-specific receptor tyrosine kinase NM_013690 172 811-982 AAAATGGCTCCTTCATCCAC TGAGCTTCACATCTCCGAAC Tert telomerase reverse transcriptase NM_009354 199 2247-2445 AGAGATAGCCAAGGCCAAGT GGAAGTGCAGGAAGAAGTCA Tert telomerase reverse transcriptase NM_009354 193 2845-3037 ACTCAGGTTATGCCCAGACC TAGGCCTGAAGCAGGAAGAT Tert telomerase reverse transcriptase NM_009354 198 585-782 CCCTCTGTGTCCGCTAGTTA AGGATAGCATCTGGCCTTCT Tert telomerase reverse transcriptase NM_009354 180 3245-3424 GGCTGCTCATTCTGTCATCT TGTTCATCTAGCGGAAGGAG Tex11 testis expressed gene 11 NM_031384 235 2804-3038 TTAGCACCCTCAAAACAAGC GTACCCACAGTGACCAGAGG Tex11 testis expressed gene 11 NM_031384 150 379-528 AACCAGGCAGCTAAACTGTG AGCAATCTGAGCATTTCCAG Tex11 testis expressed gene 11 NM_031384 216 602-817 AGGCCAACGTGTGTGTGTAT ATTTATTCCGCTTGCTTGCT Tex11 testis expressed gene 11 NM_031384 248 1530-1777 GGCTAAAGAGGCCATAGCAG CCACAAATTGCTGTCCATTC Tex11 testis expressed gene 11 NM_031384 219 797-1015 AAGCAAGCAAGCGGAATAAA GCCCAGCTGGATGTAAATGT Tex11 testis expressed gene 11 NM_031384 285 2579-2863 TGGTGGCAGATGAAGTATGG CCATGAGGTTGGCATACAGA Tex11 testis expressed gene 11 NM_031384 153 538-690 TTTCAAGCTGCCATGACTGA CCCTTGAGCAACAGCTGACT Tex11 testis expressed gene 11 NM_031384 227 1403-1629 ATGCTGATGCCCTACACTGG GAAAGCATCACCCTCCATGA Tfdp2 transcription factor Dp 2 NM_178667 173 4041-4213 ATATTGCTCTGGGTCCAACA CTCTTCAGCGCCTCAGTAAG Tgfa transforming growth factor alpha NM_031199 162 294-457 AGCATGTGTCTGCCACTCTG AGCAGTGGATCAGCACACAG Tgfa transforming growth factor alpha NM_031199 151 151-303 CAGGCTCTGGAGAACAGCAC GACACATGCTGGCTTCTCTT Tgfa transforming growth factor alpha NM_031199 CTGTGTGCTGATCCACTGCT AAGGTCTCCCAGCATGTCCC Tgfa transforming growth factor alpha NM_031199 GCTCCTGGGTGTCTGACTTC ACTGGGATGGTACTGGCTGC Tgfa transforming growth factor alpha NM_031199 167 2319-2485 CACTGGACTTCAGCCCTCTA TCCAGCAGACCAGAAAAGAC Tgfa transforming growth factor alpha NM_031199 152 GTCTTTTCTGGTCTGCTGGA TGCTAAGCGTTTACCACCTC Tgfa transforming growth factor alpha NM_031199 296 GAAGAGAAGCCAGCATGTGT TGGGATCTTCAGACCACTGT Tgfbr1 transforming growth factor, beta receptor I NM_009370 208 4429-4636 GAAGTAGTGGCCAGCTGTGT GCAGAGGGAAGAGTCAAACA Tgfbr2 transforming growth factor, beta receptor II NM_009371 232 3801-4032 GACCACCTGTGTGTGACCTC AGCTCATTCCCTGCTCTCAT Tgfbr2 transforming growth factor, beta receptor II NM_009371 182 4316-4497 AGCGGGGAATTTACAGAATG GAGGAATGACAGCGATGCTA Tgfbr2 transforming growth factor, beta receptor II NM_009371 177 1627-1803 ATGAATCTGGAAAACGTGGA CAGCACACTGTCTTTCATGC Tgfbr2 transforming growth factor, beta receptor II NM_009371 197 479-675 GCAAGTTTTGCGATGTGAGA GGCATCTTCCAGAGTGAAGC Thbs1 thrombospondin 1 NM_011580 183 2320-2502 ACTGCAAAAAGGACAACTGC GGTCTCCCACATCATCTCTG Thbs1 thrombospondin 1 NM_011580 215 213-427 TTCCTGTTGCATATGTGTGG ACAGCGTCCAGTAGGTCTTG Thbs1 thrombospondin 1 NM_011580 175 2457-2631 TACAACCCAGCCCAGTATGA CGTACTGGCAGTTGTCTCGT Thbs1 thrombospondin 1 NM_011580 162 3950-4112 AAAGCCAAAGCGCCTATTTA TGGCGGTGAGTTCTAGTGAG Ticam1 toll-like receptor adaptor molecule 1 NM_174989 152 1369-1520 TACGTATTCGGGAGAAGCTG AAAGCTAGCAGTCAGGAGCA Ticam2 toll-like receptor adaptor molecule 2 NM_173394 240 1301-1540 GGTACACTTCTGCAGCCCTA TCATGAAAGAAGCAGGAAGG TIe1 tyrosine kinase with immunoglobulin-like and EGF-like domains 1 NM_011587 166 3628-3793 GACCCAAGCTGTCTCAAGAA GAGGATCAGAAGTGGGGTTT TIe1 tyrosine kinase with immunoglobulin-like and EGF-like domains 1 NM_011587 163 1221-1383 GTTCAACATAGGGACGATGC ACTGGGCACTTCAAACTCTG TIe1 tyrosine kinase with immunoglobulin-like and EGF-like domains 1 NM_011587 256 691-946 GTACAGCCACCATCAAGTGG CCTGACAGCTCTGTCCAAAA TIe1 tyrosine kinase with immunoglobulin-like and EGF-like domains 1 NM_011587 171 437-607 TAGGCGTCTTCTCCTGTGTG TCACGTCAGTCTGCTTTTCC Timp1 tissue inhibitor of metalloproteinase 1 NM_001044384 191 297-487 AGGGCTAAATTCATGGGTTC AACTCTTCACTGCGGTTCTG Timp1 tissue inhibitor of metalloproteinase 1 NM_001044384 183 383-565 ATTCAAGGCTGTGGGAAATG CTCAGAGTACGCCAGGGAAC Timp1 tissue inhibitor of metalloproteinase 1 NM_001044384 211 192-402 GCATCTGGCATCCTCTTGTT CATTTCCCACAGCCTTGAAT Timp1 tissue inhibitor of metalloproteinase 1 NM_001044384 192 473-664 CCGCAGTGAAGAGTTTCTCA TCACTCTCCAGTTTGCAAGG Tjp2 tight junction protein 2 NM_011597 222 2738-2959 GGATGATGATGCTGAAGACC GGGCTGGATTTCCTTATGTT Tjp2 tight junction protein 2 NM_011597 220 4262-4481 GTTTGTCCGTTGTCTGGAAC GGTGAAGCAGCACTCTGAAT Tjp2 tight junction protein 2 NM_011597 160 1649-1808 GATATTTGTGGCTGGCATTC GGTCACAGTTTCACCTTTGG Tlr1 toll-like receptor 1 NM_030682 202 1586-1787 TGCAGGAACTCAATGTAGCA TTGACAAAGTCCCTCAGCTC Tlr1 toll-like receptor 1 NM_030682 199 512-710 CAACAGTCAGCCTCAAGCAT TTTTCCCCATAAGCATCTCC Tlr1 toll-like receptor 1 NM_030682 212 300-511 GGACCTACCCTTGCAAACAA GGTGGCACAAGATCACCTTT Tlr1 toll-like receptor 1 NM_030682 174 2114-2287 ATGATTCTGCCTGGGTGAAG TCTGGATGAAGTGGGGAGAC Tlr11 toll-like receptor 11 NM_205819 202 669-870 CCCAGACCTTCTGCTGAGTA CAAGTGGAGCAGTCCTGAGT Tlr11 toll-like receptor 11 NM_205819 178 945-1122 ACTTGACCTTGGGAAAAACC TGGGCCAAGCTTATTCATAG Tlr11 toll-like receptor 11 NM_205819 238 1208-1445 GGGCTTTATCCCTTTTGTCA ATCTTGGGACCCTGAAGTTG Tlr11 toll-like receptor 11 NM_205819 132 2474-2605 ctgaaggtgaaggcttgagg ctaaggcctgtcctgtgagc Tlr11 toll-like receptor 11 NM_205819 113 1126-1238 ttggagcttccagaaggact tcctggagctgtgacaaaag Tlr11 toll-like receptor 11 NM_205819 195 2676-2870 tctcctgctgttgtttctgg cagcattcctgcagtcctta Tlr2 toll-like receptor 2 NM_011905 226 1205-1430 GACGACTGTACCCTCAATGG TTAAATGCTGGGAGAACGAG Tlr2 toll-like receptor 2 NM_011905 192 366-557 TTTGGCTCTTCTGGATCTTG GGCCAATGTAGGTGATCTTG Tlr2 toll-like receptor 2 NM_011905 240 262-501 TGCTTTTCGTTCATCTCTGG AGTCCGGAGGGAATAGAGGT Tlr2 toll-like receptor 2 NM_011905 191 775-965 AACATCGCTTTTTCCCAATC GAGTCAGGTGATGGATGTCG Tlr3 toll-like receptor 3 NM_126166 211 2668-2878 CTGGGTCTGGGAACATTTCT TTGCTGAACTGCGTGATGTA Tlr4 toll-like receptor 4 NM_021297 208 1227-1434 AGACCTCAGCTTCAATGGTG GAGACTGGTCAAGCCAAGAA Tlr4 toll-like receptor 4 NM_021297 207 2232-2538 AAGGTTGAGAAGTCCCTGCT TTGTTCTCCTCAGGTCCAAG Tlr4 toll-like receptor 4 NM_021297 199 79-277 CTGACACCAGGAAGCTTGAA TGGATAAATCCAGCCACTGA Tlr4 toll-like receptor 4 NM_021297 171 3337-3507 CAGGAGGGAAAAGTGGAGAG TTCCTCCCCAAAATGTTCTC Tlr5 toll-like receptor 5 NM_016928 227 2530-2756 ACTTCATTCCAGGGGAAAAC CCCTCTGATGGTCTCATGTC Tlr5 toll-like receptor 5 NM_016928 192 2140-2331 GCTCTCCTGCAGACGTGTAT AGATTCCCCGGAACTTTATG Tlr5 toll-like receptor 5 NM_016928 153 1139-1281 TGGCTTCCAGAACATCAGAG GCAAGGTTCAGCATCTTCAA Tlr5 toll-like receptor 5 NM_016928 151 561-711 CTGGGGACCCAGTATGCTAA ACAGCCGAAGTTCCAAGAGA Tlr6 toll-like receptor 6 NM_011604 202 1589-1790 TGCAGGAACTCAATGTAGCA TTGACAAAGTCCCTCAGCTC Tlr6 toll-like receptor 6 NM_011604 161 755-915 CCGTTCTCCATTTGGTCTTT GGTTGGACCTCTGGTGAGTT Tlr6 toll-like receptor 6 NM_011604 150 528-677 GAGCCTGAGGCATCTAGACC AGATGCAAGTGAGCAACTGG Tlr6 toll-like receptor 6 NM_011604 167 1124-1290 CAAAGGAGGCGCTATACTCG GGTGGAACAGCCTTGAAAAA TLr7 toll-like receptor 7 NM_133211 249 2609-2857 ATACCTGGCCACTGATGTGA GACTCCATGGATTGCAGATG Tlr8 toll-like receptor 8 NM_133212 157 1848-2004 TGGTTTTCAGTGGAAATCGT CTCTGAGGCAAATTGAGGAA Tlr9 toll-like receptor 9 NM_031178 225 2084-2308 AGCCTCCGAGACAACTACCT GCTGAGGTTGACCTCTTTCA Tlr9 toll-like receptor 9 NM_031178 187 2547-2733 TCCTCTCTTGGGACTGCTTT AACACCACGAAGGCATCATA Tlr9 toll-like receptor 9 NM_031178 191 3227-3417 AGCTGCATCTTCATGTCTGG TCTGTGTGGGTTTGGTGTCT Tlr9 toll-like receptor 9 NM_031178 213 424-636 GCACTTCTCTTGCCACATGA TTCCCGTCCATGAAGAGAAC Tlx3 T-cell leukemia, homeobox 3 NM_019916 220 399-618 CTTTGTAAAGGACCGCTTCA CGTCATTTTGAGGGACTTTG Tlx3 T-cell leukemia, homeobox 3 NM_019916 193 628-820 GTCAAGACCTGGTTCCAAAA GATTCTGCAGAGCAAAGAGC Tlx3 T-cell leukemia, homeobox 3 NM_019916 207 528-734 GCAGATCTGTGAGCTGGAAA TGTTGCAGCTGTAGCATGAG Tlx3 T-cell leukemia, homeobox 3 NM_019916 143 403-545 gtaaaggaccgcttcacagc tccagctcacagatctgcac Tlx3 T-cell leukemia, homeobox 3 NM_019916 120 643-762 caaaatcggaggaccaagtg atcgttgaggctcttctgga Tlx3 T-cell leukemia, homeobox 3 NM_019916 201 370-570 aatttcccctggatggagag gtacttttggcgatggaagc Tlx3 T-cell leukemia, homeobox 3 NM_019916 249 628-876 gtcaagacctggttccaaaa tcacaccagagaggtgacag Tlx3 T-cell leukemia, homeobox 3 NM_019916 191 58-248 atcgaccaaatcctcaacag gccaagcttaggttgacact Tlx3 T-cell leukemia, homeobox 3 NM_019916 203 598-800 gcaaagtccctcaaaatgac gacgagttgtgcagacagag Tmed4 transmembrane emp24 protein transport domain containing 4 NM_134020 202 384-585 GCAAACTGCGTGTACACTTG CTCTGGTTGGTGCTCTCACT Tmem14a transmembrane protein 14A NM_029398 215 311-525 GACAATTGGGAGTGTTTTGG CAACTAGACCAGCAGGCATT Tmem14a transmembrane protein 14A NM_029398 220 105-324 GAACCAGCTCCAGAGAGGAC CACTCCCAATTGTCACAAGG Tmem14a transmembrane protein 14A NM_029398 207 56-262 CAGGCCGAGGACAGTAGAAG AGTCTGCACCCTTGAGCACT Tmem14a transmembrane protein 14A NM_029398 196 454-649 CTTTCTTCCTGGCCACCATA ACCACTTCAATGCAGGAACC Tnf tumor necrosis factor NM_013693 201 899-1099 CCCACTCTGACCCCTTTACT TTTGAGTCCTTGATGGTGGT Tnf tumor necrosis factor NM_013693 207 845-1051 TTGGAGTCATTGCTCTGTGA GTCCCAGCATCTTGTGTTTC Tnf tumor necrosis factor NM_013693 253 GACTAGCCAGGAGGGAGAAC CAGGAATGAGAAGAGGCTGA Tnf tumor necrosis factor NM_013693 205 TCAGCCTCTTCTCATTCCTG ACTTGGTGGTTTGCTACGAC Tnfaip3 tumor necrosis factor, alpha-induced protein 3 NM_009397 227 2009-2235 GAAAGCTGGCTGCATGTATT GGTTCTGAGCTTCGATGAAA Tnfaip3 tumor necrosis factor, alpha-induced protein 3 NM_009397 211 3819-4029 TGGGAAGGGACACAACTACA CCCCAGATGTCAGCCTTTAT Tnfaip3 tumor necrosis factor, alpha-induced protein 3 NM_009397 200 1628-1827 TGCAATGAAGTGCAGGAGTC TGGGCTCTGCTGTAGTCCTT TNFAIP6 tumor necrosis factor alpha induced protein 6 NM_009398 185 TTGGATTCCATGTCTGTGCT GACACCACCACACTCCTTTG TNFAIP6 tumor necrosis factor alpha induced protein 6 NM_009398 TCCTTTGCTTATGCGTCTTG TCTAGCTGCTTGTAGGTTGC TNFAIP6 tumor necrosis factor alpha induced protein 6 NM_009398 220 240-459 ATTTGAAGGTGGTCGTCTCG TGCATGTGGGTTGTAGCAAT TNFAIP6 tumor necrosis factor alpha induced protein 6 NM_009398 159 GAACATGATCCAGGCTGCTT GACGGATGCATCACTCAGAA Tnfrsf10b tumor necrosis factor receptor superfamily, member 10b NM_020275 200 873-1072 GAACCTGGCAAGACTCAGAA TCACGTGTGACCAGTGTTTC Tnfrsf10b KILLER/DR5 TRAIL death-inducing receptor AF176833 200 742-941 GAACCTGGCAAGACTCAGAA TCACGTGTGACCAGTGTTTC Tnfrsf10b KILLER/DR5 TRAIL death-inducing receptor AF176833 202 358-559 CGATGCAACATAACCACAAA GTCCTATCCAGAGGCCTAGC Tnfrsf10b KILLER/DR5 TRAIL death-inducing receptor AF176833 233 257-489 AGCCTTGCAGAGAGGGTATT GGGGGTACAGGAAGTCAGTT Tnfrsf10b KILLER/DR5 TRAIL death-inducing receptor AF176833 154 240-393 GTCAGAAGGGAACTGCAAGC GCATCGACACACCGTATTTG Tnfrsf11a receptor activator of nuclear factor kappa B AF019046 194 1034-1227 GGAAGATTCCCACAGAGGAT AGTGAAGTCACAGCCCTCAG Tnfrsf11b tumor necrosis factor receptor superfamily, member 11b NM_008764 201 395-595 ACTGCACAGTGAGGAGGAAG TCAAGCAGAATTCGATCTCC Tnfrsf13c tumor necrosis factor receptor superfamily, member 13c NM_028075 289 1158-1447 GTTTGATTCCCAGAATGCAC TCTGGTTAGCCTGGAACTTG Tnfrsf13c tumor necrosis factor receptor superfamily, member 13c NM_028075 217 579-795 TCTCTACTGGGCTTGTGGAC TGCAACCCTCAAGTCTATCC Tnfrsf14 tumor necrosis factor receptor superfamily, member 14 NM_178931 167 705-871 TAGCTGGATTCCTCATCTGC CCCAGAATTTGTTCAGTTGG Tnfrsf17 tumor necrosis factor receptor superfamily, member 17 NM_011608 217 127-343 TCAGTGATCCAGTCCCTCAT TGAAAAGTGCCAAAGAGAGG Tnfrsf17 tumor necrosis factor receptor superfamily, member 17 NM_011608 174 444-617 CACCGAGCTGACTAGGATCA GTGGTGACAAGAATGGTTGC Tnfrsf17 tumor necrosis factor receptor superfamily, member 17 NM_011608 200 598-797 GCAACCATTCTTGTCACCAC TCTTGGTTGGTAAACGGTCA Tnfrsf17 tumor necrosis factor receptor superfamily, member 17 NM_011608 228 301-528 atcttcttggggctgacctt ctcacaggtgcactcttcca Tnfrsf17 tumor necrosis factor receptor superfamily, member 17 NM_011608 240 53-292 ttcctgtccacagggaactc ccgtgtacgtccctttcact Tnfrsf18 tumor necrosis factor receptor superfamily, member 18 NM_009400 243 99-341 AGGTCAGCCGAGTGTAGTTG CGGAAGCCAAACACAATATC Tnfrsf18 tumor necrosis factor receptor superfamily, member 18 NM_009400 194 778-971 CCCAGCTATACCCTTGGTGA TGCTAAACGTGGTGCTCTTG Tnfrsf18 tumor necrosis factor receptor superfamily, member 18 NM_009400 210 306-515 GGTGGAGTCTCAAGGGGATA ATGACAGTCAAATGGCCGTA Tnfrsf18 tumor necrosis factor receptor superfamily, member 18 NM_009400 166 113-278 tagttgaggagcctggctgt ttgcagatcttgcactgagg Tnfrsf18 tumor necrosis factor receptor superfamily, member 18 NM_009400 157 636-792 gttgtcagctgaggatgctt aagggtatagctgggcaagt Tnfrsf1a tumor necrosis factor receptor superfamily, member 1a NM_011609 191 428-618 TTGTGTCCCCAAGGAAAGTA CGACATGTCTTGCAACTGAG Tnfrsf1a tumor necrosis factor receptor superfamily, member 1a NM_011609 190 1375-1564 TCTGTATGCTGTGGTGGATG CACTACTTCCAGCGTGTCCT Tnfrsf1a tumor necrosis factor receptor superfamily, member 1a NM_011609 177 540-716 TCTGCAGGGAGTGTGAAAAG TCTCACTCAGGTAGCGTTGG Tnfrsf1a tumor necrosis factor receptor superfamily, member 1a NM_011609 228 1730-1957 ACTCCCTGTGGGTGAAAAGT CAAGTGGGCACCAGATACAT Tnfrsf1a tumor necrosis factor receptor superfamily, member 1a NM_011609 191 428-618 TTGTGTCCCCAAGGAAAGTA CGACATGTCTTGCAACTGAG Tnfrsf21 tumor necrosis factor receptor superfamily, member 21 NM_178589 212 1354-1565 CCACCACAGACACATTCTGA TGGAGCTCTTTCGGATACTG Tnfrsf25 tumor necrosis factor receptor superfamily, member 25 NM_033042 193 73-265 GACAGTGAGAGGGAAGCTGA AGCAGCAGTGGTAGGAACAG Tnfrsf4 tumor necrosis factor receptor superfamily, member 4 NM_011659 165 284-448 TCACAAGTGCTGTCGTGAGT TCACTTCCACTTCGATGGTT Tnfrsf4 tumor necrosis factor receptor superfamily, member 4 NM_011659 202 736-937 CTGTCCAATCCACCACAGTC CTGTTTCCCCAACAAGGTTT Tnfrsf4 tumor necrosis factor receptor superfamily, member 4 NM_011659 224 363-586 CCGTGTGAGACTGGCTTCTA TTGTTGCCTGGAGAAAAGTG Tnfrsf4 tumor necrosis factor receptor superfamily, member 4 NM_011659 199 491-689 atgtagaccaggcacccaac caggaggcttctgtcctcac Tnfrsf4 tumor necrosis factor receptor superfamily, member 4 NM_011659 189 567-755 cacttttctccaggcaacaa gactgtggtggattggacag Tnfrsf8 tumor necrosis factor receptor superfamily, member 8 NM_009401 159 439-597 CTCCACTGTTCTGGAGAGGA TAGAGTAGGCATGGCCTGAG Tnfrsf8 tumor necrosis factor receptor superfamily, member 8 NM_009401 153 1292-1444 CGGAACACACCAATAACAGG GGGCATGGTCCACTTCTAGT Tnfrsf8 tumor necrosis factor receptor superfamily, member 8 NM_009401 242 791-1032 TCAGCACCTCAGAAAACAGC CAGGTGAAACTTCTGCTGGA Tnfrsf8 tumor necrosis factor receptor superfamily, member 8 NM_009401 160 651-810 ccttgtgcaggaagatgcta gctgttttctgaggtgctga Tnfrsf8 tumor necrosis factor receptor superfamily, member 8 NM_009401 189 595-783 ctagaatccccagccaatga gagtgtccctggagatggaa Tnfrsf9 tumor necrosis factor receptor superfamily, member 9 NM_011612 194 76-269 TCCAGCTGCCACTATTCTTC GCTCTTGCAGACTGGATTGT Tnfrsf9 tumor necrosis factor receptor superfamily, member 9 NM_011612 161 1762-1922 CCTCTGTGTCAGGCTTTTCA CTTGAGCTGTCCAGGAGTCA Tnfrsf9 tumor necrosis factor receptor superfamily, member 9 NM_011612 243 616-858 TGGTGAGCTTCTCTCCCAGT ATCGGCAGCTACAAGCATCT Tnfrsf9 tumor necrosis factor receptor superfamily, member 9 NM_011612 249 929-1177 cgaaaccgagaagcactagg ctcaggcatcaggagtgtca Tnfrsf9 tumor necrosis factor receptor superfamily, member 9 NM_011612 282 1691-1972 ctgtctggaggaagcctgac agagggaggtgctgtctcaa Tnfrsf9 tumor necrosis factor receptor superfamily, member 9 NM_011612 133 30-162 ctcagcacagagagctgaca tgaccaccacgttgtaacag Tnfrsf9 tumor necrosis factor receptor superfamily, member 9 NM_011612 173 459-631 gagctaacgaagcagggttg ggagagaagctcaccacagg Tnfrsf9 tumor necrosis factor receptor superfamily, member 9 NM_011612 208 271-478 gccctccaagtaccttctcc caaccctgcttcgttagctc Tnfsf10 tumor necrosis factor (ligand) superfamily, member 10 NM_009425 208 2123-2330 CCACTCCACCTACCAAGATG GAGAATTGAACCTGGGTCCT Tnfsf10 tumor necrosis factor (ligand) superfamily, member 10 NM_009425 190 262-451 GGATGAGGATTTCTGGGACT TGCCACTTTCTGAGGTCTTC Tnfsf10 tumor necrosis factor (ligand) superfamily, member 10 NM_009425 195 2754-2948 TGAAAGCTCAAGATGGAAGG ACTTGGGGACCAGGAATTAG Tnfsf10 tumor necrosis factor (ligand) superfamily, member 10 NM_009425 224 44-267 ATTGGGAAGTCAGACCTGGA TCATCCGTCTTTGAGAAGCA Tnfsf10 tumor necrosis factor (ligand) superfamily, member 10 NM_009425 234 2164-2397 GATGTTGGTGCCTGGAGTTT AAGCAAAGGGCAGAAAGTCA Tnfsf10 tumor necrosis factor (ligand) superfamily, member 10 NM_009425 229 3586-3814 GAAGCCTGTGATGCAGGAAG ATCATTGTCCCTGTGCTTGC Tnfsf11 tumor necrosis factor (ligand) superfamily, member 11 NM_011613 239 1748-1986 AATTCCCCTGAAGGTACTCG TCCTTTTTGGCTATGTCAGC Tnfsf11 tumor necrosis factor (ligand) superfamily, member 11 NM_011613 189 586-774 TATGATGGAAGGCTCATGGT ACCCTTAGTTTTCCGTTGCT Tnfsf11 tumor necrosis factor (ligand) superfamily, member 11 NM_011613 231 1078-1308 GGCTTTCAAAGTTCAGGACA CCGTTGTGTAATCACCATGA Tnfsf11 tumor necrosis factor (ligand) superfamily, member 11 NM_011613 208 167-374 agccgagactacggcaagta gcgctcgaaagtacaggaac Tnfsf11 tumor necrosis factor (ligand) superfamily, member 11 NM_011613 250 884-1133 accagcatcaaaatcccaag tccatgctaatgttccacga Tnfsf11 tumor necrosis factor (ligand) superfamily, member 11 NM_011613 169 821-989 catcatgaaacatcgggaag atcccccaacatttatggaa Tnfsf12 tumor necrosis factor (ligand) superfamily, member 13 NM_02351 240 423-662 AGACAGAGCTGCAAAGCCTA CAGAGTCTGCCTTGGAGGTA Tnfsf12 tumor necrosis factor (ligand) superfamily, member 13 NM_011614 219 878-1096 CAGCCAGAGCTTGTTCACAT GCCTAGTCCCAGGTTCTCTG Tnfsf12 tumor necrosis factor (ligand) superfamily, member 13 NM_011614 180 170-349 AGGAGGAGCTGACAGCAGAG GCCGAGGATGAACCTCATAA Tnfsf13b tumor necrosis factor (ligand) superfamily, member 13b NM_033622 228 971-1198 CCCTGTTCCGATGTATTCAG TCGGAGGTACAGAGAAGACG Tnfsf13b tumor necrosis factor (ligand) superfamily, member 13b NM_033622 221 52-272 TTCAGGGTAGCAAAAGATGC TTCTCGGAGCAAAAACAGAG Tnfsf14 tumor necrosis factor (ligand) superfamily, member 14 NM_019418 189 1378-1566 CAGGAATGGTTGGTCAGAAG CAACTCCAGGAATCCAACAG Tnfsf14 tumor necrosis factor (ligand) superfamily, member 14 NM_019418 274 144-417 TTCAGTGTTTGTGGTGGATG TCCTGTAAGATGTGCTGCTG Tnfsf14 tumor necrosis factor (ligand) superfamily, member 14 NM_019418 245 877-1123 CTCTCCAGGACTCACCTCAA AGCCGAAATCTCAGTGTTTG Tnfsf14 tumor necrosis factor (ligand) superfamily, member 14 NM_019418 173 996-1168 TCAGAGACCTGGAGACTTGG TGATGACACTCTGGGAAGGT Tnfsf4 tumor necrosis factor (ligand) superfamily, member 4 NM_009452 174 71-244 GCTCCTTTGTGGTGAAGAGC CAGAGACCACCAGCCTTAGC Tnfsf4 tumor necrosis factor (ligand) superfamily, member 4 NM_009452 243 318-560 CCCTCCAATCCAAAGACTCA ATCCTTCGACCATCGTTCAG Tnfsf4 tumor necrosis factor (ligand) superfamily, member 4 NM_009452 222 977-1198 CGGTCAGAAGCTCATCGTAA CGGGGTAATCTTCTTTCCAA Tnfsf8 tumor necrosis factor (ligand) superfamily, member 8 NM_009403 235 1788-2022 AGCCGTTCTAGTGCTGTGTC GTCCTGTACCATGCAACTCC Tnfsf8 tumor necrosis factor (ligand) superfamily, member 8 NM_009403 206 153-358 GGAACAGAGCTGGGTACAGA AGTAGCTGCGACTTGTGCTT Tnfsf8 tumor necrosis factor (ligand) superfamily, member 8 NM_009403 211 1415-1625 TCCTAAGGACTTCCATGCTG GAAGCTCTTCCCACATTCAA Tnfsf9 tumor necrosis factor (ligand) superfamily, member 9 NM_009404 166 858-1023 GTGGGTCTGAGGGCTTATCT AGCAGCTTGAGGACTTAGCA Tnfsf9 tumor necrosis factor (ligand) superfamily, member 9 NM_009404 157 514-670 AAGCATCGTTGTGCAATACA GGACTGAGCTTCAGTTCCAA Tnfsf9 tumor necrosis factor (ligand) superfamily, member 9 NM_009404 239 723-961 CAAGCAAAGCCTCAGGTAGA TCGGGTTTCACAAGAAAGAG Tnfsf9 tumor necrosis factor (ligand) superfamily, member 9 NM_009404 116 217-332 cctaccctgcggttaatgtt gatcagaagcagcaaaacca Tnfsf9 tumor necrosis factor (ligand) superfamily, member 9 NM_009404 86 401-486 cctgggtacccgagagaata caggagagccctgttgtgta Tnfsf9 tumor necrosis factor (ligand) superfamily, member 9 NM_009404 146 674-819 attcacaaacacaggccaca tccaggaacggtccactaac Tollip Toll interacting protein NM_023764 181 669-849 ACTGTGTACCAGCAGGGTGT AACGGATTACTTCCCTGTCC Tollip Toll interacting protein NM_023764 191 1100-1290 AGCAGGCAGTCCTCTTCATT TATCTTGGCAGAGGCAGTTG Tollip Toll interacting protein NM_023764 152 1595-1746 GGTATCCAGACCTGGTGCTT GACTCTGGGCTCTGTGATGA Tollip Toll interacting protein NM_023764 231 3224-3454 ATTGCTGCTCTTGCCAAGTT ATCGGGTAGGCATCACTCAC Top2b topoisomerase (DNA) II beta NM_009409 222 GTCGGCAAACCCAAAGTAAA TGGGGTCAATGTCTCCTCTC Top2b topoisomerase (DNA) II beta NM_009409 189 GAAAGCGTGGAAAGAAGCAC CGCCCTTTCGTATCTCTCTG Top2b topoisomerase (DNA) II beta NM_009409 226 GGCCATCACTTTTGAAGCAT ATGCGATGCCTTTCCATATC Tpr translocated promoter region NM_133780 208 6930-7137 CCACTACGCCTCTCCAAGTA AGGCCTGCCTCTGAACTAAT Tradd TNFRSF1A-associated via death domain NM_001033161 209 1070-1278 CTGCTGACCACTTTCCATCT GCACCTTGAGCTAGGTTTCA Tradd TNFRSF1A-associated via death domain NM_001033161 206 567-772 AGCTTCTGCAGGTTCGAAGT CTCTCAGTGCCCGACAGTTA Tradd TNFRSF1A-associated via death domain NM_001033161 197 507-703 GGAGGATGAGCTCTGCAAAC CAAACGTCTGCTGGTCTTGA Tradd TNFRSF1A-associated via death domain NM_001033161 249 1120-1368 CCTAGCTGAGCTGCTGGAGT TTATCGCTGCAGACAAGGTG Tradd TNFRSF1A-associated via death domain NM_001033161 227 793-1019 GCCTACGAGTATGAGCGTGA AACACTGAACTGCTGGTTGG Tradd TNFRSF1A-associated via death domain NM_001033161 243 1000-1242 CCAACCAGCAGTTCAGTGTT AGAGGGTCTTTGCAGCAAGT Traf1 Tnf receptor-associated factor 1 NM_009421 210 639-848 AGACAACCTCCATCCTGTGA GGTGAGGATTTCCACTCCTT Traf1 Tnf receptor-associated factor 1 NM_009421 153 1850-2002 atgctggttatggctgatgt cctgatctaggctggtctca Traf1 Tnf receptor-associated factor 1 NM_009421 165 1526-1690 agcatgctattgatgccttc tgcatttgaggaacattgtg Traf2 Tnf receptor-associated factor 2 NM_009422 204 320-523 GAGAGTAGTTCGGCCTTTCC CTCAGTGTGGTGCTCCTTCT Traf2 Tnf receptor-associated factor 2 NM_009422 217 2549-2765 gttgtgctcatggcttctct cagctcttctgggtccacta Traf2 Tnf receptor-associated factor 2 NM_009422 162 1188-1349 ctatcttctccccagccttc tctgattaaaaggccactgc Traf3 Tnf receptor-associated factor 3 NM_011632 239 3983-4221 CCTCTTCCTCTAGGCCTGTC CACCCTCATACAAGGGTCTG Traf3 Tnf receptor-associated factor 3 NM_011632 197 1264-1460 actgagctggagagcgtaga cgcttgtagtcacggatctt Traf3 Tnf receptor-associated factor 3 NM_011632 216 783-998 ggtatcctgccctcacaagt ttcttctccagggagttgct Traf4 Tnf receptor associated factor NM_009423 217 3389-3605 ATAGAATTCAGGGCACACCA CTAGTCAGCAGGTGGGAAGA Traf4 Tnf receptor associated factor NM_009423 183 825-1007 ctttgttctctgccctttca tcgctgcctatggatagttc Traf4 Tnf receptor associated factor NM_009423 201 3762-3962 gggcttaatgggaaaacaga tttctttggtggtggcaata Traf5 Tnf receptor-associated factor 5 NM_011633 246 1239-1484 TCTCAAATGTCCAGGCTCTC TCAGCTGTGCTTTGTGGATA Traf5 Tnf receptor-associated factor 5 NM_011633 229 1812-2040 tggagaccttcaaagctgac acaccttttcctgtgctgag Traf5 Tnf receptor-associated factor 5 NM_011633 228 931-1158 tccaagagctagggtgaatg tggatcttgctttccttctg Traf6 Tnf receptor-associated factor 6 NM_009424 201 4544-4744 GGCCATCTTTCCTTACCAAT TCCAGAAGAAAGCAGAATGG Trip TRAF-interacting protein NM_011634 184 491-674 AAGGCAGAGATGCTGTGTTC CCATGTCTCGAATCATCTCC Trip TRAF-interacting protein NM_011634 220 655-874 ggagatgattcgagacatgg ctgggctgacctcagttcta Trip TRAF-interacting protein NM_011634 174 1394-1567 atccagcctagggacacaac aggtcttggcccactaattg Trp53 transformation related protein 53 NM_011640 220 924-1143 AGCTTTGAGGTTCGTGTTTG GGAACATCTCGAAGCGTTTA Trp73 transformation related protein 73 NM_011642 245 1317-1561 GCAACAGGCTCTGAATGAAA GCTGCTGTCGATAGGAGTCA Trp73 transformation related protein 73 NM_011642 215 3586-3800 tgggatagcctcagagtcag tcagcactggtctctgacaa Trp73 transformation related protein 73 NM_011642 184 3953-4136 cacaaagcctgaggttgact cacaggcctaggagtgagaa Tsc22d1 TSC22 domain family, member 1 NM_207652 159 1815-1973 GTGTGGCTCTCCAACAGCTA GAGGGACAGGCTGAAGAGTC Tsc22d1 TSC22 domain family, member 1 NM_207652 178 2473-2650 CGGTCAACAGGCAAACATAC TGCAATGACCAATTGTTGTG Tsc22d1 TSC22 domain family, member 1 NM_207652 218 3040-3257 AGGCGGCTTACCTCAGACTA AATGGCTTTTCACCAGATCC Twist1 twist gene homolog 1 NM_011658 227 1296-1522 ATCAGCCACTGACAGGAAAG GCATTTTACCATGGGTCATC Twist1 twist gene homolog 1 NM_011658 175 1229-1403 CCCCACTTTTTGACGAAGAA CAGTTTGATCCCAGCGTTTT Twist1 twist gene homolog 1 NM_011658 165 1178-1342 CCACACCTCTGCATTCTGAT TAAAATGGAGCCAGTCCACA Twist1 twist gene homolog 1 NM_011658 158 1380-1537 AATAAAAACGCTGGGATCAA ACACCGGATCTATTTGCATT Uba1 ubiquitin-like modifier activating enzyme 1 NM_009457 185 861-1045 AAGTACAGGGCATGATCCAA AGGCTCTACCAGTGATGCTG Uba1 ubiquitin-like modifier activating enzyme 1 NM_009457 226 2282-2507 CTGCACAACTTTCCTCCTGA GGGTGAACTCTGGGACTTGT Uba1 ubiquitin-like modifier activating enzyme 1 NM_009457 237 1111-1347 TCTGCACCAATTCTGTGCTC GAGCAGGCCTTCATGACTTC Uba1 ubiquitin-like modifier activating enzyme 1 NM_009457 152 1211-1362 tccccaccttcagtaaaaca ggcataaactttccagagca Uba1 ubiquitin-like modifier activating enzyme 1 NM_009457 176 2659-2834 ggatgatgacagcaatttcc agagctccagacacacaagg Ubc ubiquitin C NM_019639 220 92-311 ACAACTCCGTGAGAGAGACG AGGGTGGACTCTTTCTGGAT Ubc ubiquitin C NM_019639 159 56-214 ACACAAAGCCCCTCAATCTC CCTCCTTGTCCTGGATCTTT Ulk1 Unc-51 like kinase 1 NM_009469 170 4765-4934 TGATGTGGGGTTTCAGAGTT TTACATGCAAGGGAGGTCAT Ulk2 Unc-51 like kinase 2 NM_013881 240 3261-3500 CAAGCAGCAGCTTAAGAAGG GCTGAATGAAGCCACTCACT Ulk2 Unc-51 like kinase 2 NM_013881 229 1951-2179 ATGACCCTCGTGAGTGTTCC AATGCCAGCATAACACCACA Ulk2 Unc-51 like kinase 2 NM_013881 207 4850-5056 CATGCAGGCTCCTACAGACA CACCAACCTTACCCTCTCCA Ulk2 Unc-51 like kinase 2 NM_013881 155 1421-1575 GCAGACAGGAGGACGAAGAC GCACTGGAGAACCTGAGGAG Ulk3 unc-51-like kinase 3 BC151153 153 1365-1517 CGAGCTGAATACCTGAAGGA CTCTCTAGGGTTGTGCTCCA Ulk3 unc-51-like kinase 3 BC151153 217 1495-1711 GGATGGAGCACAACCCTAGA GGACAGGCTTAGACCAGCAG Ulk3 unc-51-like kinase 3 BC151153 209 297-505 TTCCAGTGGGACAATGACAA TCCAAAGAGCTCAGCAGGAT Ulk3 unc-51-like kinase 3 BC151153 205 747-951 GTGATTGAGCTCCCTCTTCG CCTCCTGGTCCTTCTTCACA Ulk4 unc-51-like kinase 4 BC109364 174 326-499 AGCTGATCTACACGGACTCG TTGAGGACCAGCAACTTCTC Ulk4 unc-51-like kinase 4 BC109364 234 241-474 CCCAGCTCACCTCAGAAGAC AATATGCCGGTAGGTGCAAG Ulk4 unc-51-like kinase 4 BC109364 210 1195-1404 AGGTGGGTCTCAATGCAGTC TGTACAGCAGCACCAGGAAG Ulk4 unc-51-like kinase 4 BC109364 175 1409-1583 GATTCATAACCGGGACATGC GGTCGAAATACCTGCGACAT Unc5b unc-5 homolog B NM_029770 248 3359-3606 AGGAATGGTCCTTCAACTCC CAGGACCATGTGAACACAGA Unc5b unc-5 homolog B NM_029770 231 876-1106 AACTTTGACCAGGAGCCTCT GATATTCTTGGCCACACAGG Unc5b unc-5 homolog B NM_029770 225 3997-4221 GGAAAGGCTTTGCTATGTCA CAGGAATCACCAAACAGACC Unc5b unc-5 homolog B NM_029770 216 565-780 TCCTATTGGAGCCACAGGAC CGAAGAGTTCCTCCACTTGC Unc5b unc-5 homolog B NM_029770 228 4666-4893 GGGCTCTGAGACAGACCAAG GTGGAGCATCCCAGGATAAA Unc5b unc-5 homolog B NM_029770 204 3101-3304 CTTCGCCACCAAAGCTAGTC CTCCTTGCACCGTCTCCTAC Usf2 upstream transcription factor 2 NM_011680 154 725-878 TTCTCCGAAAATTGATGGAA TGTCTTGCTGTTGTCTGCAT Usf2 upstream transcription factor 2 NM_011680 217 487-703 CGCTGGCTGTAATTCAAAAT ATTGTCCTCTGTGTGCCTGT Usf2 upstream transcription factor 2 NM_011680 245 276-520 AGTAATGGAGGCCAGGTGAC CCATTGCTGAATGGATTTTG Usf2 upstream transcription factor 2 NM_011680 243 1027-1269 AGAATGAGAATGCCCTGCTT AGGGTAGTGGGCAACGTATC Usf2 upstream transcription factor 2 NM_011680 233 773-1005 AGCTCAGCACAATGAAGTGG TGAGGAGCTCATTGTCCATC Usp18 ubiquitin specific peptidase 18 NM_011909 242 627-868 TCAGTGCCTGCAGAAATACA GCTTTGCGTCCTTATCAAAA Usp18 ubiquitin specific peptidase 18 NM_011909 249 1002-1250 AACCTTGACCATTCACCTCA CAGAACCACTTTCCATCCAC Usp18 ubiquitin specific peptidase 18 NM_011909 235 904-1138 GTCCAGCCCAAAGAGTTAGC CCTTGGTATCACCGAGGTCT Uvrag UV radiation resistance associated gene NM_178635 223 1019-1241 AAGTGCATTTTCCACTGAGC CTCGGAATTAGGCAACTTGA Vdr vitamin D receptor NM_009504 192 2064-2255 GTTCCCACCTTTGAGGTTTT GACCTCCATTTGTTGTCCTG Vdr vitamin D receptor NM_009504 198 985-1182 ACTGTGGCAGCCAAGACTAC CAACCAGCTTAGCATCCTGT VEGFA vascular endothelial growth factor A NM_001025250 195 GAAAGGGAAAGGGTCAAAAA CACATCTGCAAGTACGTTCG VEGFA vascular endothelial growth factor A NM_001025250 215 AGCAGATGTGAATGCAGACC CAACGCGAGTCTGTGTTTTT Vegfb vascular endothelial growth factor B NM_011697 217 815-1031 AGAGCTCAACCCAGACACCT TTGTTAGATGGCAGCTCTGG Vegfb-4 vascular endothelial growth factor B NM_011697 168 392-559 AACTAGTGCCCAGCTGTGTG CACATTGGCTGTGTTCTTCC Vegfb-5 vascular endothelial growth factor B NM_011697 239 858-1096 TGACAAGCTGCTTTCCAGAC TGACCAGGGTGGTTAAGTGA Vip vasoactive intestinal polypeptide NM_011702 212 435-646 ACAGCAGACTTCTGGGTCAG ATCTCCCTCACTGCTCCTCT Vip vasoactive intestinal polypeptide NM_011702 245 992-1236 TTTCTGCAAGGGTAGCAATC ATGAATCCGTGAGAGATGGA Vip vasoactive intestinal polypeptide NM_011702 173 267-439 TGAGTAGGCTGGATGACAGG GCTGTAATCGCTGGTGAAAA Wdr45l Wdr45 like NM_025793 247 1596-1842 CTGTTCAGAGCACACACTGG GAGAAGGCCCCTCAGTAAAG Wdr45l Wdr45 like NM_025793 176 761-936 TCATCAGGGCATTTAATCCA CTGGCTGATGCCAAACTAGA Wdr45l Wdr45 like NM_025793 189 336-524 AACCGAAATACCCTCCCAAC TTTCAAAGACGTGCAACTGG Wdr45l Wdr45 like NM_025793 162 1414-1575 TAGCATTAATGGCACCACCA GGGTGCTCTACCAGACAAGC Whrn (Dfnb31) whirlin NM_001008792 162 2297-2458 CTACAGCGACACAGGCTCAT TCTTCTGAGGGGGATTTGAC Whrn (Dfnb31) whirlin NM_001008792 231 3557-3788 GAAGAAGAGGGCCAGACAAG TCATTTGTGGCACTGAAGGT Whsc2 Wolf-Hirschhorn syndrome candidate 2 NM_011914 203 1483-1685 ACACAGAGGATCTGCCCAAG TCAGGTCACTCAGCACAACC Whsc2 Wolf-Hirschhorn syndrome candidate 2 NM_011914 263 1360-1622 TGTTCAAGACGGCAAACAAG TGGCACTTAGGACACATTGG Whsc2 Wolf-Hirschhorn syndrome candidate 2 NM_011914 187 GTGGTAGAAAAGCCCACCAA GAGTCTCAGAGCTGGGGATG Wif1 Wnt inhibitory factor 1 NM_011915 193 840-1032 AAAGCAAACTGCTCAACCAC TAGAGCACAGGTCTCCTTGG Wif1 Wnt inhibitory factor 1 NM_011915 215 1084-1298 ACAAGTGCCAGTGTCGAGAG TGAACCCGGTGTAACTTGAA Wif1 Wnt inhibitory factor 1 NM_011915 242 517-758 AAGTTGGTTTCCCGTGTCTC TATGCACAGGGCTTTCTCAC Wif1 Wnt inhibitory factor 1 NM_011915 227 1112-1338 CGGCAGACACTGCAATAAGA GCATTTGAACATCCAACACG Wif1 Wnt inhibitory factor 1 NM_011915 164 1318-1481 GCGTGTTGGATGTTCAAATG TGTCCCAAAAGGACTGAAGG Wif1 Wnt inhibitory factor 1 NM_011915 183 434-616 CTCCCTGGATAAAGGCATCA GGGGTCCTAAGGATGGTGTT Wipi1 WD repeat domain, phosphoinositide interacting 1 NM_145940 239 928-1166 TGGCAGCTACCAACTACCTC TCCTGAGCTAAGCAAGCTGT Wipi2 WD repeat domain, phosphoinositide interacting 2 NM_178398 201 2434-2634 CTCCCCAGACATAGCAGAGA CTGGGGTGTAGTGTGAGACC Wipi2 WD repeat domain, phosphoinositide interacting 2 NM_178398 209 3576-3784 CCACAGAGGTCAGAAAAGCA GCTGGGATTACAGGTGTGTG Wipi2 WD repeat domain, phosphoinositide interacting 2 NM_178398 223 821-1043 GAGGGACAGAAGCTGTTTGA AGGGCAGGTAGCTGGTAGAT Wipi2 WD repeat domain, phosphoinositide interacting 2 NM_178398 172 1847-2018 TAGGAGAGCAAGTGGAGTGG GCAAGAGGACTCCTGACAGA Wnt2 wingless-related MMTV integration site 2 NM_023653 CAACAGAGCTGGAAGGAAGG AGGTCATTTTTCGTTGGCTTC Wnt2 wingless-related MMTV integration site 2 NM_023653 CACTGGACCTCTGGGTTGTT TGTCATGCCATTTCCAAAAA Wnt2 wingless-related MMTV integration site 2 NM_023653 159 1004-1162 GCTATGACACATCCCACGTC TCTGCTGAGGTCATGTAGGC Wnt2 wingless-related MMTV integration site 2 NM_023653 167 489-655 GAAGAAAGGAAGTGCCAAGG TCCTTCCAGCTCTGTTGTTG Wnt2 wingless-related MMTV integration site 2 NM_023653 196 620-815 CCCTGATGAACCTTCACAAC CCCTGGTTCATGACTACCTG Xcr1 Chemokine (C motif) receptor 1 NM_011798 228 2511-2738 GGCCAAAGACAGAACTCAGA GAGATACCATGTGGGCTTTG Xcr1 Chemokine (C motif) receptor 1 NM_011798 215 4049-4263 ATGCTGAAGTCTGGCAGATG CTGAAGCCTGGTGCAATAGA Xcr1 Chemokine (C motif) receptor 1 NM_011798 170 1777-1946 GGCAACAGCTGCTAACACAT CTGGACCTTCTTGGATGGAT Xcr1 Chemokine (C motif) receptor 1 NM_011798 236 249-484 GGGTAACAGCCTGGTTTTGT GGTGGATGGTCATGATGGTA Xiap X-linked inhibitor of apoptosis NM_009688 165 1769-1933 TGTGGACATCTGGTCACTTG CTTAAAGTTCGCTCCCATCA Xist nuclear-localized inactive X-specific transcript X59289 161 383-543 TGTGGTCTGCTTTGTCTTCA ACAAAGAACAAGTGGGGTGA Xist nuclear-localized inactive X-specific transcript X59289 222 1813-2034 CAGCCAGTGTCACCTTCTTT AGGAAGGCACGAAAAAGATT Xist nuclear-localized inactive X-specific transcript X59289 227 3734-3960 AATATTTGCCTGGTGTGCAA TGTTCGCTCAACACATAGCA Zap70 zeta-chain (TCR) associated protein kinase NM_009539 157 1507-1663 CTATGCCAAGATCAGCGACT ATAGCTCCAGACGTCACTGC Zap70 zeta-chain (TCR) associated protein kinase NM_009539 186 814-999 GAAGGCGGATGGACTAATTT TTGTCTGTCGATGACGCTAA Zap70 zeta-chain (TCR) associated protein kinase NM_009539 188 1043-1230 TACAGCGACCCTGAGGAACT TCTTTGTCGGCCTTCTCTGT Zbp1 Z-DNA binding protein 1 NM_021394 217 1433-1649 CTTTCCTGCCTCAAGATCAA TCAGTATTTCCCATGGCTGT Zbp1 Z-DNA binding protein 1 NM_021394 228 489-716 AATGACGACAGCCAAAGAAG TTTGAATTGGCAATGGAGAT Zbp1 Z-DNA binding protein 1 NM_021394 239 1137-1375 GTCAAAGGGTGAAGTCATGG TGCTCAGTCCTGTGTCTTGA Znf446 zinc finger protein 446 NM_017908 152 790-941 GATGCGATGCTGGAGAAGTA GGTGGACCCTCACTCTCATT Znf446 zinc finger protein 446 NM_017908 225 301-525 AAGGAGCAGATGCTGGAGAT CCCAAGTGGTTCCTCTGTCT Znf446 zinc finger protein 446 NM_017908 150 1686-1835 GAGGTCTGGGTTCCCTTCTA AGGCACAGTTTTTGAACACC Znf446 zinc finger protein 446 NM_017908 190 629-818 ATGTCGATGGACAGGAAGTG ACTGTGCCGTACTTCTCCAG Znf446 zinc finger protein 446 NM_017908 178 1064-1241 CACCTGCAGAGACGAGACTG GGTGGCTTCTCTGTGCTTTC Znf446 zinc finger protein 446 NM_017908 228 568-795 CCCCAGGACACCAGAATAGA CGCATCCCAGTACAGTTCCT Znf446 zinc finger protein 446 NM_017908 224 209-432 GGTTCTGCTACCAGGAGGTG CTGCAGTCCTTCGACTAGGG Znf446 zinc finger protein 446 NM_017908 132 690-821 GAACCATGGACACCAAGAAC ACCACTGTGCCGTACTTCTC Znf446 zinc finger protein 446 NM_017908 107 1140-1246 CGACTGGAAGTCAGTGTTCG CTTGTGGTGGCTTCTCTGTG