Mouse SCN4a-mGH (20800-49120)

Bases 2128 - 2360

 

Forward Primer:5'-CAGACCTCCCAGGTTAGCAC-3'

Reverse Primer: 5'- TGGGAAGAGTAGGCTTGTGG - 3'

 

Product Size: 232 b.p.

Primer Concentration: 10 pM

Annealing Temperature: 58°C

Magnesium Chloride Concentration:

Instrument: Roche LightCycler

 

Submitted by: Dr. Vasudeva Ginjala

Institution: Dept. of Genetics, University of Pennsylvania