Enterovirus Echovirus 9

 

Forward Primer:5'- CCTCCGGCCCCTGAATGCGGCTAAT -3'

Reverse Primer: 5'- ATTGTCACCATAAGCAGCCA - 3'

 

Product Size: 153 b.p.

Primer Concentration: 0.5 micromolar

Annealing Temperature: 55°C

Magnesium Chloride Concentration: 3 mM

Instrument: LightCycler

 

Submitted by: Unknown

Institution: