Escherichia coli B, dnaK gene

 

Forward Primer:5'- TCGTATGCCAATGGTTCAGA -3'

Reverse Primer: 5'- TCCGGGTTAACGTCTTTACG - 3'

 

Product Size:

Primer Concentration:

Annealing Temperature:

Magnesium Chloride Concentration:

Instrument:

 

Submitted by:

Institution: