Neuropeptide Y Y1 receptor

 

Forward Primer:5'- GTGGCTGGAGGCCAAACAAC -3'

Reverse Primer: 5'- GGCAGTGTCCAAGGGGAAGA - 3'

 

Product Size: 185

Primer Concentration:

Annealing Temperature: 60

Magnesium Chloride Concentration:

Instrument:

 

Submitted by:

Institution: