Synaptic vesicle glycoprotein 2a

 

Forward Primer:5'- TGCGTCTGAAGTCAGTGTCC -3'

Reverse Primer: 5'- CGGCTGTTCACGAACTTGTA - 3'

 

Product Size: 153 b.p.

Primer Concentration:

Annealing Temperature: 60°C

Magnesium Chloride Concentration: 3 mM

Instrument: BioRad iCycler

 

Submitted by: Adrinel Vazquez

Institution: