Beta Actin

 

Forward Primer:5'- TGTTTGAGACCTTCAACACC -3'

Reverse Primer: 5'- TAGGAGCCAGGGCAGTAATC - 3'

 

Product Size: 599 b.p.

Primer Concentration: 0.7 micromolar

Annealing Temperature: 63°C

Magnesium Chloride Concentration: 3 mM

Instrument: Perkin Elmer ABI Prism 7900HT Sequence Detection System

 

Submitted by: Rudolph Spangler

Institution: The Rockefeller University