Transforming growth factor, beta 1

 

Forward Primer:5'- GGAAAGGGCTCAACACCTG -3'

Reverse Primer: 5'- CAGTTCTTCTCTGTGGAGCTGA - 3'

 

Product Size: 84 b.p.

Primer Concentration:

Annealing Temperature:

Magnesium Chloride Concentration:

Instrument: BioRad

 

Submitted by: Hongyu Zhang

Institution: University of Michigan